94% of researchers rate our articles as excellent or good
Learn more about the work of our research integrity team to safeguard the quality of each article we publish.
Find out more
REVIEW article
Front. Oncol.
Sec. Molecular and Cellular Oncology
Volume 15 - 2025 | doi: 10.3389/fonc.2025.1543215
A review on the role of MiR-193a-5p in oncogenesis and tumor progression
Provisionally accepted- Changsha Central Hospital (The Affiliated Changsha Central Hospital, Hengyang Medical School, University of South China), Changsha, China
MicroRNA (miRNA), a class of short non-coding RNA molecules comprising 18-25 nucleotides, are pivotal regulators of gene expression within physiological environments, influencing processes such as cell growth, apoptosis, proliferation, differentiation, migration (including cellular movement), and angiogenesis. They also play a crucial role in disease progression, invasion, and metastasis. Specifically, miR-193a-5p, a member of the miR-193a family, is instrumental in the development of various malignancies, including osteosarcoma, hepatocellular carcinoma, cervical cancer, melanoma, gastrointestinal cancer, lung cancer, prostate cancer, and bladder cancer. Studies have revealed that miR-193a-5p (sequence: UGGGUCUUUGCGGGCGAGAUGA; accession number: MIMAT0004614) is downregulated in numerous cancer cell lines and clinical samples. Furthermore, the tumor-suppressive effects of miR-193a-5p have been corroborated in animal models across different cancer types. These studies suggest that overexpression of this miRNA or modulation of lncRNA expression can inhibit oncogenesis. In this review, we summarize the functions of miR-193a-5p in cancer development.
Keywords: miR-193a-5p, Cancer, Expression, malignancies, modulation
Received: 11 Dec 2024; Accepted: 21 Feb 2025.
Copyright: © 2025 Tang, Rao, Pi and Li. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
* Correspondence:
Jin-ping Li, Changsha Central Hospital (The Affiliated Changsha Central Hospital, Hengyang Medical School, University of South China), Changsha, China
Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.