This article is a correction to:
Evaluation of the rbcL marker for metabarcoding of marine diatoms and inference of population structure of selected genera
Timotej Turk Dermastia
Ivano Vascotto
Janja Francé
David Stanković
Patricija Mozetič- 1Marine Biology Station Piran, National Institute of Biology, Piran, Slovenia
- 2Jožef Stefan International Postgraduate School, Ljubljana, Slovenia
- 3Department of Organisms and Ecosystems Research, National Institute of Biology, Ljubljana, Slovenia
A corrigendum on
Evaluation of the rbcL marker for metabarcoding of marine diatoms and inference of population structure of selected genera
by Turk Dermastia, T., Vascotto, I., Francé, J., Stanković, D., and Mozetič, P. (2023). Front. Microbiol. 14:1071379. doi: 10.3389/fmicb.2023.1071379
In the published article, there was an error. In section 2. Methods, 2.3. Amplification and Illumina MiSeq sequencing, the forward primer 708F-DEG has been incorrectly pasted as the same as the 18S-V9R primer. The paragraph previously stated:
“Two markers were chosen for metabarcoding, namely the 150 base pair (bp) 18S-V9 region and a ~ 312 bp barcode within the rbcL chloroplast gene. The primers used to amplify the 18S gene were the universal eukaryotic 18S-V9F (TTGTACACACCGCCCGTCGC) and 18S-V9R (CCTTCYGCAGGTTCACCTAC; Piredda et al., 2017). Libraries for the rbcL barcode were built using the diatom-specific primers 708F-DEG (CCTTCYGCAGGTTCACCTAC) and R3-DEG (CCTTCTAATTTACCWACWACWG), both modified from Vasselon et al. (2017a).”
The corrected sentence appears below:
“Two markers were chosen for metabarcoding, namely the 150 base pair (bp) 18S-V9 region and a ~312 bp barcode within the rbcL chloroplast gene. The primers used to amplify the 18S gene were the universal eukaryotic 18S-V9F (TTGTACACACCGCCCGTCGC) and 18S-V9R (CCTTCYGCAGGTTCACCTAC; Piredda et al., 2017). Libraries for the rbcL barcode were built using the diatom-specific primers 708F-DEG (AGGTGAAGYWAAAGGTTCWTAYTTAAA) and R3-DEG (CCTTCTAATTTACCWACWACWG), both modified from Vasselon et al. (2017a).”
The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.
Publisher's note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Keywords: rbcL, metabarcoding, monitoring, diatoms, population genetics, Pseudo-nitzschia, Adriatic
Citation: Turk Dermastia T, Vascotto I, Francé J, Stanković D and Mozetič P (2023) Corrigendum: Evaluation of the rbcL marker for metabarcoding of marine diatoms and inference of population structure of selected genera. Front. Microbiol. 14:1328336. doi: 10.3389/fmicb.2023.1328336
Received: 26 October 2023; Accepted: 30 October 2023;
Published: 10 November 2023.
Edited and reviewed by: Tony Gutierrez, Heriot-Watt University, United Kingdom
Copyright © 2023 Turk Dermastia, Vascotto, Francé, Stanković and Mozetič. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Timotej Turk Dermastia, timotej.turkdermastia@nib.si