AUTHOR=Yang Min , Huang Jie , Zheng Decai , Tang Haizhan , Liu Junchi , Luo Jian , Wen Xin 

TITLE=ERK1/2 regulates melanin synthesis in fish: a case study on a colourful variety, leopard coral grouper (Plectropomus leopardus)

JOURNAL=Frontiers in Marine Science

VOLUME=11

YEAR=2024

URL=https://www.frontiersin.org/journals/marine-science/articles/10.3389/fmars.2024.1441589

DOI=10.3389/fmars.2024.1441589

ISSN=2296-7745

ABSTRACT=<p>Understanding the molecular mechanism of melanogenesis in <italic>Plectropomus leopardus</italic> is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of <italic>P. leopardus</italic> skin tissues in red-skinned and black-skinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in <italic>P. leopardus</italic>, the full-length sequences of the <italic>erk1/2</italic> and <italic>mitf</italic> genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different red-skinned and black-skinned <italic>P. leopardus</italic> tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in <italic>P. leopardus</italic>, and when <italic>erk1/2</italic> expression was decreased in <italic>P. leopardus</italic>, <italic>mitf</italic> expression increased accordingly. On the one hand, through short-term <italic>in vivo</italic> injection of <italic>erk1/2</italic>-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of long-term interference showed that when <italic>erk1/2</italic> expression was decreased in <italic>P. leopardus</italic>, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, <italic>in vitro</italic> Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in <italic>P. leopardus.</italic> These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in <italic>P. leopardus</italic> and provides a new perspective for exploring the variable skin colouration of coral reef fish.</p>