The final, formatted version of the article will be published soon.
ORIGINAL RESEARCH article
Front. Mar. Sci.
Sec. Marine Fisheries, Aquaculture and Living Resources
Volume 11 - 2024 |
doi: 10.3389/fmars.2024.1441589
This article is part of the Research Topic Towards an Expansion of Sustainable Global Marine Aquaculture View all 9 articles
ERK1/2 regulates melanin synthesis in fish:A case study on a colorful variety, leopard coral grouper (Plectropomus leopardus)
Provisionally accepted- Hainan University, Haikou, China
Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and black-skinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different red-skinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of long-term interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treates fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro COimmunoprecipitation (CO-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish.
Keywords: Plectropomus leopardus, ERK1/2, skin colour, MITF, melanogenesis
Received: 31 May 2024; Accepted: 28 Aug 2024.
Copyright: © 2024 Wen, Yang, Huang, Zheng, Tang, Liu and Luo. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
* Correspondence:
Xin Wen, Hainan University, Haikou, China
Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.