
95% of researchers rate our articles as excellent or good
Learn more about the work of our research integrity team to safeguard the quality of each article we publish.
Find out more
ORIGINAL RESEARCH article
Front. Immunol. , 22 November 2024
Sec. Inflammation
Volume 15 - 2024 | https://doi.org/10.3389/fimmu.2024.1462352
This article is part of the Research Topic Modulation of Pro-Inflammatory Signaling by Interferons View all 5 articles
Introduction: TLR7 detects the presence of single-stranded RNA (ssRNA) viruses, including human T-lymphotropic virus 1 (HTLV-1), and triggers antiviral and inflammatory responses that are responsible for infection control. Genetic variations in the TLR7 gene may alter cytokine production and influence the course of HTLV-1 infection. In the present study, the associations of TLR7 gene polymorphisms with HTLV-1-related symptoms, receptor expression levels, IFN-α and TNF-α levels and the proviral load were investigated.
Methods: Blood samples from 159 individuals with HTLV-1 infection (66 with inflammatory diseases and 93 asymptomatic individuals) and 159 controls were collected. The genotyping of polymorphisms, TLR7 gene expression analysis and the quantification of the proviral load were performed by real-time PCR, and cytokine measurement was performed by enzyme-linked immunosorbent assay (ELISA).
Results: Carriers of the polymorphic allele for TLR7 rs179008 (A/T) had lower levels of IFN-α, while carriers of the polymorphic allele for TLR7 rs3853839 (C/G) had higher levels of TLR7 and IFN-α expression. The polymorphisms were not associated with symptoms of diseases related to HTLV-1 infection. The combination of A/G alleles for the TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms was associated with increased IFN-α levels and a decreased proviral load.
Discussion: Although the polymorphisms did not influence the presence of symptoms of diseases caused by HTLV-1, carriers of the wild-type alleles for TLR7 rs179008 (A/T) and the polymorphism for TLR7 rs3853839 (C/G) appears to have a stronger antiviral response and increased infection control.
Human T-lymphotropic virus 1 (HTLV-1) is the causative agent of adult T-cell leukemia (ATL) and several types of inflammatory conditions, including HTLV-1-associated myelopathy (HAM), uveitis, infectious dermatitis, rheumatoid arthritis, bronchitis and bronchiectasis (1, 2). It is estimated that 5 to 10 million people worldwide are infected with the virus (3), approximately 5% of whom may develop some of the diseases and conditions associated with HTLV-1 (4).
The factors responsible for triggering the manifestations of HTLV-1-associated diseases are not fully understood. Therefore, several studies have investigated the association of inflammatory molecular markers, especially those for HAM, with susceptibility to infection and the presence of diseases and have shown that variations in the expression of these markers may contribute to the pathogenesis of HTLV-1-infection-associated diseases (5, 6). Genetic variations in components of immunity have been associated with changes in the inflammatory response, susceptibility to infection and the presence of HTLV-1-related diseases (7–9).
Toll-like receptors (TLRs) recognize pathogen-associated molecular patterns (PAMPs) in innate immunity and play essential roles in the immune response against viral infection (10–12). TLR7 is located in the endosome and recognizes single-stranded RNA (ssRNA) of several viruses, such as HTLV. The activation of TLR7 triggers a signaling cascade, inducing the production of type I interferons (IFN-α and IFN-β), which are responsible for suppressing viral replication and inflammatory cytokines (10, 13, 14). The role of IFN-α in HTLV-1 infection was evaluated in an experimental study in different cell lines, which demonstrated that IFN-α suppresses the expression of HTLV-1 genes, resulting in the inhibition of p19 and the HTLV-1 tax protein (15), although the virus is also capable of reducing IFN-I signaling, evading the immune response (16). Another host cell mechanism against viral infections is the inflammatory response, mediated by the production of cytokines (17). However, in HTLV-1 infection, the marked increase in inflammatory cytokines, mainly TNF-α and IFN-γ, can induce the development of diseases (18, 19).
The TLR7 gene is located on the X chromosome and has several polymorphisms potentially associated with human diseases (20–22). The TLR7 rs179008 (A/T) single nucleotide polymorphism (SNP) promotes an amino acid change, glutamine to leucine (Gln11Leu), in the protein structure of the receptor. This change alters receptor functionality and intracellular signaling and has been linked to several viral infections, including human immunodeficiency virus 1 (HIV-1), hepatitis C virus (HCV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (12, 23–26).
The TLR7 rs3853839 SNP (C/G) is located in the intergenic noncoding region (3’ UTR) and has been associated with different types of diseases. This genetic variant may have a substantial impact on gene expression, as the 3’ UTR is an essential regulatory region, regulating the translation, degradation and subcellular localization of mRNAs (27–29). The TLR7 rs3853839 (G/C) variation was found to be associated with the severity of coronavirus disease 2019 (COVID-19) (30) and with the persistence of HCV infection (29).
Because information on the role of TLR7 in HTLV-1 infection is limited, and there is lack of studies on the influence of genetic variations in the TLR7 gene on infection, in the present study, the associations of TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) with susceptibility to HTLV-1 infections, the presence of symptoms of inflammatory diseases associated with infection, TLR7 gene expression, IFN-α, inflammatory cytokines and the proviral load were investigated.
The present study included 159 blood samples from individuals living with HTLV-1 infection, comprising 66 patients with a clinical diagnosis of inflammatory diseases (HAM, n=46; rheumatological manifestations, n=18; dermatitis, n=1; and uveitis, n=1) and 93 asymptomatic patients. All individuals who presented a clinical diagnosis of inflammatory disease were defined as symptomatic. Individuals of both sexes, aged over 18 years, without treatment with glucocorticoids and treated at the outpatient clinic of the Tropical Medicine Center and Care Service for People Living with HTLV (SAPEVH), both a part of the Federal University of Pará, were included. Individuals with co-infection and autoimmune disease were excluded from the study.
A 10 mL sample of blood was collected by intravenous puncture into a vacuum collecting tube containing ethylenediaminetetraacetic acid (EDTA) as an anticoagulant. The samples were centrifuged and separated into aliquots of plasma and leukocytes. The leukocyte samples were used for genomic DNA extraction to TLR7 SNPs (rs179008 and rs3775291) genotyping and quantify the proviral load. Plasma samples were used for the evaluation of plasma cytokine levels.
The control group consisted of 159 blood samples from individuals negative for infection by HTLV-1/2, HIV-1/2, HCV and hepatitis B virus (HBV), over 18 years of age and without diagnosis of an autoimmune disease. These control samples were used to compare the frequencies of polymorphisms in HTLV-1 samples. The control group was matched in age and sex with a group of people with HTLV-1. As individuals in the control group were from the same population as individuals in the HTLV-1 group; therefore, there were no interethnic differences between groups.
DNA was extracted from leukocytes from whole blood using a Puregene™ kit (Gentra Systems, Inc., Minneapolis, Minnesota, USA) following the manufacturer’s protocol, which consisted of cell lysis, protein precipitation and precipitation and hydration of the DNA. After extraction, the DNA obtained was quantified by spectrophotometric reading on a BioDrop™ instrument (Bio-Rad, Hercules, California, USA) following the protocol recommended by the manufacturer.
The genotypes of the investigated polymorphisms were identified by real-time PCR using the StepOnePLUS™ Real-Time PCR System (Thermo Fisher, Carlsbad, California, USA). The reactions consisted of the following commercially obtained TaqMan™ assays: TLR7 rs179008 (C:_2259574_10) and TLR7 rs3853839 (C:_2259573_10), with primers and probes specific for amplification of the target sequence (Thermo Fisher, Carlsbad, California, USA). The reaction consisted of 1X MasterMix, H2O, 20X assay C_11537906_20 and 50 ng of DNA. The following cycling conditions were used: 10 minutes at 95°C and 40 cycles of 15 seconds at 95°C and 1 minute at 60°C.
Total RNA was extracted from peripheral blood leukocytes using the TRIzol™ Plus RNA Purification Kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA). The steps followed the protocol recommended by the manufacturer. The concentration of the extracted RNA was determined using a BioDrop™ (Bio-Rad, Hercules, California, USA) according to the manufacturer’s instructions. All total RNA samples had concentrations equal to 50 ng/µL for the synthesis of complementary DNA (cDNA).
The synthesis of cDNA from RNA was performed using the High-Capacity cDNA Reverse Transcription® with RNAse Inhibitor Kit (Applied Biosystems, Foster City, CA, USA). For each reaction, a mixture with a final volume of 20.0 µL was prepared, contained 2 µL of 10X RT Buffer, 0.8 µL of 25X dNTP Mix (100 nM), 2 µL of random primer, 1 µL of MultiScribe™ Reverse Transcriptase, 1 µL of RNaseOUT™ and 3.2 µL of ultrapure water supplied in the kit and 10.0 µL of extracted RNA. Subsequently, the mixture was placed in a Mastercycler personal thermal cycler (Eppendorf, Hamburg, Germany) and subjected to cycles of 25°C for 10 minutes, 37°C for 120 minutes and 85°C for 5 minutes.
Gene expression was performed by quantifying mRNA by real-time PCR. First, the standardization of the quantitative PCRs (qPCRs) with the cDNAs and probes (endogenous and target genes) was performed to calculate the efficiency of the amplification reactions. In the standardization reactions, different concentrations of cDNA were tested (pure and in 4 dilutions with a factor of 2—1:2, 1:4, 1:8 and 1:16). All reactions were performed on plates and in triplicate, and the same cDNA (at different dilutions) was analyzed with different probes to construct an efficiency curve to validate the 2-ΔΔCT analysis method. All tests showed efficiency as expected (100% ± 10) (31).
The relative quantification of gene expression consisted of the amplification of the target gene with the endogenous gene (normalizer) using TaqMan™ assays (Applied Biosystems, Foster City, CA, USA) and the StepOnePLUS™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The reactions were performed in the singleplex format according to the manufacturer’s protocol. The assay used for TLR7 was Hs01933259_s1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control (Hs02786624_g1). All assays were obtained commercially (Thermo Fisher Scientific, Waltham, MA, USA). For the reaction, 5 µL of 2X TaqMan® Universal PCR Master Mix, 0.5 µL of 20X TaqMan Gene Expression Assay, 1 µL of cDNA and 10.5 µL of RNAse-free water were used, along with the following thermocycling conditions: 2 minutes at 50°C, followed by 10 minutes at 95°C and 1 minute at 60°C.
The relative quantification (RQ) of target gene expression was determined using the comparative CT method (ΔΔCt) with the formula 2-ΔΔCT, where ΔΔCt = ΔCt sample- ΔCt reference (Life Technologies, Carlsbad, CA, USA).
The plasma levels of the cytokines IFN-α and TNF-α were measured using the Ready-SET-Go® enzyme-linked immunosorbent assay (ELISA) (eBioscience, California, San Diego, USA), which uses specific monoclonal antibodies to detect each cytokine and measure its level. The test was performed according to the manufacturer’s instructions.
The proviral load was quantified by qPCR using a TaqMan® system (Applied Biosystems, Foster City, CA) with two target sequences (the albumin gene as an endogenous control and the nonhomologous region of the HTLV-1 pol gene), according to a previously described protocol (32), which starts with the extraction of DNA from leukocytes, followed by relative quantification via real-time PCR, using reaction-specific primers and probes: HTLV-1-F: GAACGCTCTAATGGCATTCTTAAAACC, HTLV-1-R: GTGGTTGATTGTCCATAGGGCTAT and HTLV-1-Probe: FAM-ACAAACCCGACCTACCC-NFQ for HTLV-1; ALB-F: GCTCAACTCCCTATTGCTATCACA, ALB-R: GGGCATGACAGGTTTTGCAATATTA and ALB-Probe: FAM-TTGTGGGCTGTAATCAT-NFQ for endogenous control (albumin). The result is further adjusted to an absolute proviral quantification considering the leukocyte count per mm3, and the result is expressed as the number of proviral DNA copies/mm3.
The genotypic and allelic frequencies of the polymorphisms were estimated by direct counting, and the significance of the differences between the studied groups was calculated using the chi-square (χ2) test, Fisher’s exact test and the G test. The choice of tests was based on the assumptions of sample size and number of categories, as already established (33). The Hardy-Weinberg equilibrium calculation was performed to evaluate whether the observed genotypic frequency distributions were in accordance with expectations. Analyses of the normality of the distribution of TLR7 expression levels, the proviral load and cytokine levels were performed using the Shapiro−Wilk test. The TLR7 expression levels, proviral load levels and cytokine levels among the investigated groups were evaluated using the nonparametric Mann−Whitney test. The multiple logistic regression test evaluated the associations of the investigated variables with the presence of disease symptoms. Multiple linear regression analysis was performed to evaluate the association between the gene expression of TLR7, INF-α and TNF-α in relation to polymorphic alleles of TLR7 rs17008, polymorphic alleles of TLR7 rs3853839 and the proviral load of the virus. All tests were performed using BioEstat 5.3 and GraphPad Prism 5.0 software, those with a value of p ≤ 0.05 were considered significant associations.
This study was submitted to and approved by the Ethics Committee for Research with Human Beings of the Institute of Health Sciences of the Federal University of Pará (CAAE no. 63427822.3.0000.0018). All individuals included in the study signed an informed consent form.
Of the 159 individuals living with HTLV-1 included in the study, 111 (69.81%) were female and 48 were male (30.19%), with a mean age of 49.95 years (19-80 years). The majority of individuals in the asymptomatic group (66.7%; n=62) and symptomatic (74.2%; n= 49) were female (p= 0.3812). The mean age of the asymptomatic group was 48 years and the symptomatic group was 51.1 years (p= 0.2146). The samples from the control group were paired for sex and age with those from the HTLV-1 group. Because the TLR7 gene is located on the X chromosome, comparisons of the genotypic frequencies of the TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms between the investigated groups were initially performed according to sex. Next, an evaluation was performed, regardless of sex, of the frequency of alleles related with (allele T) and without (allele A) alteration in the structure of the TLR7 protein for the rs179008 (A/T) polymorphism and with (allele G) and without (allele C) alterations in the expression levels of the TLR7 gene for the rs3853839 (C/G) polymorphism. The comparison between the frequency of genotypes for the TLR7 rs179008 A/T polymorphism between the control and HTLV-1 groups did not show significant differences according to sex, although the frequency of the polymorphic allele (T) was greater in females in the HTLV-1 group, with a p value close to significance. The genotypic frequencies of the TLR7 rs3853839 variation (C/G) did not differ between the groups in both sexes (Table 1).
Table 1. Comparison of the genotypic frequencies of the investigated polymorphisms in the TLR7 gene between the control and HTLV-1 groups according to sex.
The analysis of genotypic frequencies for TLR7 rs179008 (A/T) showed that female individuals with symptoms of HTLV-1-associated diseases had a greater frequency of polymorphic genotypes (AT and TT) than individuals without symptoms (p= 0.0260). The frequency of the polymorphic allele (T) was greater in the symptomatic (OR= 2.32; p= 0.0250). The symptomatic group had a greater frequency of carriers of the homozygous and heterozygous (AT+TT) polymorphic genotypes than the symptomatic group (OR = 3.00; p = 0.0019). Among male individuals, there was no significant difference in the frequency of genotypes for the TLR7 rs179008 (A/T) polymorphism between the groups with and without disease symptoms. The comparison of the genotype frequencies of the TLR7 rs3853839 (C/G) variation was not different between the groups in both sexes (Table 2).
Table 2. Comparison of the genotypic frequencies of the investigated polymorphisms in the TLR7 gene between asymptomatic individuals and those with symptoms of HTLV-1-associated diseases according to sex.
The frequency of individuals carrying the TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms was also evaluated regardless of sex. For the TLR7 rs179008 (A/T) polymorphism, individuals were classified as carriers of the A allele, including the AA (female) and A (male) genotypes; the A allele is related to the maintenance of the TLR7 receptor structure. Carriers of the T allele included individuals with AT and TT (feminine) and T (male) genotypes; the T allele is related to changes in TLR7 protein structure. For the TLR7 rs3853839 (C/G) variation, individuals were classified as carriers of the C allele, including the CC (female) and C (male) genotypes; the C allele is unrelated to alterations in TLR7 gene expression. Carriers of the G allele included those with the CG and GG (female) and G (male) genotypes; the G allele is associated with increased TLR7 expression levels.
The evaluation of the frequencies of carriers with T and A allele for the TLR7 rs179008 (A/T) polymorphism did not significantly differ between the control group and the HTLV-1 group. A similar result was observed when comparing the frequencies of carriers of the G and C allele for the TLR7 rs3853839 (C/G) polymorphism between the investigated groups (Table 3).
Table 3. Frequency of carriers of alleles related to alteration in protein structure for the TLR7 rs179008 (A/T) polymorphism and carriers of alleles related to changes in expression levels for TLR7 rs3853839 (C/G) between the control and HTLV-1 groups.
According to the presence and absence of symptoms associated with HTLV-1 infection, the frequency of carriers of alleles related to structural alterations in the protein (T) for the TLR7 rs179008 (A/T) polymorphism was greater in the symptomatic group (OR= 3.10; p= 0.0030). The frequencies of carriers of alleles related (G) and not related (C) to changes in TLR7 expression levels for the TLR7 rs3853839 variation (C/G) were not significantly different between groups (Table 4).
Table 4. Frequency of carriers of alleles related to alteration in protein structure for the TLR7 rs179008 (A/T) polymorphism and carriers of alleles related to changes in expression levels for TLR7 rs3853839 (C/G) between asymptomatic individuals and those with symptoms of HTLV-1-associated diseases.
TLR7 gene expression levels were higher in the symptomatic group than in the asymptomatic group, but there was no statistically significant difference (p= 0.0642; Figure 1A). In the evaluation of TLR7 expression levels in relation to the TLR7 rs179008 (A/T) polymorphism, no differences were observed in the levels of TLR7 expression between individuals carrying the alleles related (T allele) and not related (A allele) to the alteration of the protein structure of TLR7 in individuals with HTLV-1 (Figure 1B). There were also no differences in the levels of TLR7 expression between carriers of the A and T alleles according to the absence (Figure 1C) or presence (Figure 1D) of symptoms associated with HTLV-1 infection.
Figure 1. Evaluation of TLR7 gene expression levels between (A) Asymptomatic individuals and those with symptoms of HTLV-1-associated diseases; (B) Individuals living with HTLV-1; (C) asymptomatic individuals and (D) symptomatic individuals carrying the alleles related and not related to alterations in the protein structure for the TLR7 rs179008 (A/T) polymorphism. (E) Individuals living with HTLV-1, (F) asymptomatic individuals and (G) symptomatic individuals carrying the alleles related and not related to changes in expression levels for TLR7 rs3853839 (C/G). RQ, relative quantification. Mann-Whitney test. Allele A: includes carriers of the AA (female) and A (male) genotypes; allele T: includes carriers of the AT and TT (female) and T (male) genotypes; allele C: includes carriers of the CC (female) and C (male) genotypes; Allele G: includes carriers of the CG and GG (female) and G (male) genotypes.
The evaluation of TLR7 expression levels in relation to the TLR7 rs3853839 polymorphism (C/G) revealed that individuals who were HTLV-1 carriers of the allele related to changes in receptor expression levels (G) had higher TLR7 expression levels (p= 0.0215; Figure 1E). According to the analysis of the presence and absence of symptoms of diseases associated with HTLV-1, in the asymptomatic group, individuals carrying the G allele had higher levels of TLR7 gene expression (p= 0.0336; Figure 1F). In contrast, no differences in the levels of TLR7 expression were observed between individuals carrying the C and G alleles in the symptomatic group (Figure 1G).
IFN-α levels did not differ between individuals with and without symptoms associated with HTLV-1 infection (Figure 2A). Regarding the TLR7 rs179008 (A/T) polymorphism, individuals with HTLV-1 carrying the allele related to alterations in the structure of the TLR7 protein (T allele) had lower levels of IFN-α than individuals carrying the allele not related to alteration (A allele) (p= 0.0241; Figure 2B). In the group of asymptomatic individuals, carriers of the T allele also had lower IFN-α levels than carriers of the A allele (p= 0.0219; Figure 2C). However, there were no differences in IFN-α levels between individuals carrying alleles related and not related to changes in the structure of the TLR7 protein in the symptomatic group (Figure 2D).
Figure 2. Evaluation of IFN-α levels. (A) Asymptomatic individuals and those with symptoms of HTLV-1-associated diseases. (B) Individuals living with HTLV-1, (C) asymptomatic individuals and (D) symptomatic individuals carrying the alleles related and not related to alterations in the protein structure for the TLR7 rs179008 (A/T) polymorphism. (E) Individuals living with HTLV-1, (F) asymptomatic individuals and (G) symptomatic individuals carrying the alleles related and not related to changes in expression levels for TLR7 rs3853839 (C/G). Mann-Whitney test. Allele A: includes carriers of the AA (female) and A (male) genotypes; allele T: includes carriers of the AT and TT (female) and T (male) genotypes; allele C: includes carriers of the CC (female) and C (male) genotypes; Allele G: includes carriers of the CG and GG (female) and G (male) genotypes.
For the TLR7 rs3853839 (C/G) polymorphism, there were no significant differences in cytokine levels between individuals carrying the alleles related (G) and not related (C) to alterations in the levels of TLR7 expression in individuals with HTLV-1 (Figure 2E) and according to the absence (Figure 2F) and presence (Figure 2G) of symptoms of HTLV-1-associated diseases.
The levels of the inflammatory cytokine TNF-α were greater in the symptomatic group than in the asymptomatic group (p= 0.0179; Figure 3A). However, to TLR7 rs179008 (A/T) polymorphism for there was no difference in cytokine levels between individuals who were carriers of alleles related (T) and not related (A) to alterations in the structure of the TLR7 protein in individuals with HTLV-1 (Figure 3B) or according to the absence (Figure 3C) and presence (Figure 3D) of symptoms of diseases associated with infection. For TLR7 rs3853839 (G/C), TNF-α levels were not associated with alleles related (G) and not related (C) to changes in TLR7 expression levels in individuals with HTLV-1 (Figure 3E) or according to the absence (Figure 3F) and presence (Figure 3G) of symptoms of diseases associated with the virus.
Figure 3. Evaluation of TNF-α levels. (A) Asymptomatic individuals and those with symptoms of HTLV-1-associated diseases. (B) Individuals living with HTLV-1, (C) asymptomatic individuals and (D) symptomatic individuals carrying the alleles related and not related to alterations in the protein structure for the TLR7 rs179008 (A/T) polymorphism. (E) Individuals living with HTLV-1, (F) asymptomatic individuals and (G) symptomatic individuals carrying the alleles related and not related to changes in expression levels for TLR7 rs3853839 (C/G). Mann-Whitney test. Allele A: includes carriers of the AA (female) and A (male) genotypes; allele T: includes carriers of the AT and TT (female) and T (male) genotypes; allele C: includes carriers of the CC (female) and C (male) genotypes; Allele G: includes carriers of the CG and GG (female) and G (male) genotypes.
The proviral loads were evaluated according to the presence and absence of symptoms of diseases associated with HTLV-1 (Figure 4A), the alleles related (T) and not related (A) to alterations in the protein structure for the TLR7 rs179008 polymorphism (A/T) (Figures 4B-D) and the alleles related (G) and not related (C) to a change in TLR7 expression levels for the TLR7 rs3853839 polymorphism (C/G) (Figures 4E–G). However, there were no differences in cytokine levels in any of the analyses.
Figure 4. Evaluation of HTLV-1 proviral loads. (A) Asymptomatic individuals and those with symptoms of HTLV-1-associated diseases. (B) Individuals living with HTLV-1, (C) asymptomatic individuals and (D) symptomatic individuals carrying the alleles related and not related to alterations in the protein structure for the TLR7 rs179008 (A/T) polymorphism. (E) Individuals living with HTLV-1, (F) asymptomatic individuals and (G) symptomatic individuals carrying the alleles related and not related to changes in expression levels for TLR7 rs3853839 (C/G). Mann-Whitney test. Allele A: includes carriers of the AA (female) and A (male) genotypes; allele T: includes carriers of the AT and TT (female) and T (male) genotypes; allele C: includes carriers of the CC (female) and C (male) genotypes; Allele G: includes carriers of the CG and GG (female) and G (male) genotypes.
Evaluation of TLR7, IFN-α, TNF- α and proviral load levels in relation to females showed that only carriers of the AA genotype for TLR7 rs179008 (A/T) had significantly higher levels of IFN-α (Supplementary Table S1).
Multiple logistic regression was used to evaluate whether the investigated variables could be associated with the presence of symptoms of HTLV-1-related diseases. The analysis showed that only increased proviral load contributed to the outcome of symptoms (OR: 0.010; 95% CI: 1,001 to 1,030; p= 0.0236) (Table 5).
Table 5. Multiple logistic regression analysis of the variables investigated in relation to symptoms of HTLV-1-associated diseases.
Multiple linear regression analysis revealed an association between the rs3853839 polymorphism (C/G) and an increase in TLR7 expression levels (β: 1.281; 95% CI: 0.433 to 2.128; p= 0.0036). Regarding IFN-α, the polymorphic allele (T) for the TLR7 rs179008 (A/T) polymorphism was associated with a decrease in cytokine levels (β: - 1.241; 95% CI: -21.102 to -3.713; p= 0.0059). The polymorphic allele (G) for the TLR7 rs3853839 polymorphism (C/G) was associated with an increase in IFN-α levels (β: 8.718; 95% CI: 0.194 to 17.241; p= 0.0452). Increased TNF-α levels were associated with the polymorphic allele (T) for the TLR7 rs179008 (A/T) polymorphism (β: 5.320; 95% CI: 1.291 to 9.348; p= 0.0151) and with increased proviral load (β: 0.005; 95% CI: 0.001 to 0.008; p= 0.0017) (Table 6).
Based on the results of the multiple linear regression analysis showing a different relationship between IFN-α levels and the polymorphic alleles for the TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms, IFN-α levels and the other markers were evaluated according to the combination of the following alleles for these polymorphisms: (i) T/C (changes in receptor structure and lower expression levels of TLR7), (ii) A/G (preserved receptor structure and increased TLR7 expression levels), (iii) A/C (preserved receptor structure and decreased TLR7 expression levels) and (iv) T/G (changes in receptor structure and increased TLR7 expression levels).
There was no significant difference in TLR7 expression levels between individuals with different combinations, but individuals with combinations that included the G allele to TLR7 rs3853839 (C/G) polymorphism had higher TLR7 expression levels (Figure 5A). IFN-α levels were significantly greater in individuals with the A/G allele than in individuals with the T/C allele combination (p= 0.0220; Figure 5B). The levels of TNF-α (Figure 5C) and the proviral load (Figure 5D) were not significantly different between individuals carrying the different combinations of alleles for the TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms. However, carriers of the A/G alleles had lower HTLV-1 proviral loads (Figure 5D). The comparison of the medians of IFN-α levels and the viral loads of patients with HTLV-1 was influenced by the combination of the A/G alleles. Individuals carrying these alleles had higher levels of IFN-α and lower proviral loads (Figures 5E, F).
Figure 5. Comparison of the levels of (A) IFN-α, (B) TLR7 gene expression, (C) TNF-α and (D) HTLV-1 proviral load according to the combination of alleles for the TLR7 rs179008 (A/T) and TLR7 allele rs3853839 (C/G) polymorphisms. Evaluation of (E) median IFN-α levels and proviral loads in relation to the combination of alleles for the polymorphisms; (F) correlation of IFN-α levels and proviral loads in individuals with the A/G combination. Kruskal-Wallis test (A-E). Spearman correlation test (F). Allele A: includes carriers of the AA (female) and A (male) genotypes; allele T: includes carriers of the AT and TT (female) and T (male) genotypes; allele C: includes carriers of the CC (female) and C (male) genotypes; Allele G: includes carriers of the CG and GG (female) and G (male) genotypes.
TLR7 recognizes ssRNA and induces the production of large amounts of IFN-α and inflammatory cytokines, which are responsible for promoting the control of viral infections (34). Variations in TLR7 expression levels may influence the development of chronic diseases caused by HBV infection (35), the process of fibrosis induced by HCV infection (36), HIV-1 viremia (37) and induce the pathogenesis of SARS-CoV-2 (38).
Initially, the present study revealed an association of the polymorphic allele of the TLR7 rs179008 (A/T) polymorphism with the presence of symptoms of HTLV-1-associated diseases. However, multiple logistic regression analysis revealed that the TLR7 rs179008 polymorphism (A/T) and the TLR7 rs3853839 variation (C/G) were not associated with clinical manifestations resulting from viral infection. On the other hand, both bivariate analysis and multiple linear regression showed an association of the TLR7 rs179008 (A/T) polymorphism with reduced levels of IFN-α and of the polymorphic allele for the TLR7 rs3853839 genetic variation (C/G) with increased TLR7 gene expression levels.
The TLR7 rs179008 (A/T) polymorphism was associated with a worse prognosis during the course of HIV-1 infection; individuals with this polymorphism had greater viral loads and faster progression to immunosuppression (23). In these individuals, the TLR7 rs179008 (A/T) polymorphism decreased the production of IFN-α (23). Women with acute HIV-1 infection carrying the TLR7 rs179008 (A/T) polymorphism had reduced viral load and lower frequency of clinical symptoms (24). In SARS-CoV-2 infection, the TLR7 rs179008 (A/T) polymorphism was associated with the severity of COVID-19 (26). Regarding the TLR7 rs3853839 (C/G) variation, the polymorphic allele was associated with a greater likelihood of individuals developing COVID-19, with disease severity and poor clinical parameters, including hospitalization, respiratory failure, cardiac complications, intensive care unit hospitalization and mechanical ventilation (30). In enterovirus 71 (EV71) infection, the G allele was associated with a lower risk of serious diseases related to higher TLR7 gene expression and IFN-α levels (39). Although individuals with HCV infection carrying the TLR7 rs3853839 (C/G) polymorphism exhibited higher TLR7 gene expression and IFN-α levels than did those with the wild-type genotype, the frequency of the wild-type genotype was greater in the group with persistent infection (29).
These results show the relevance of the TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms in the context of viral infections, as these polymorphisms seem to contribute to the evolution of infections caused by different viruses, including HTLV-1. However, it is important to note that the association of polymorphisms may be influenced by other factors inherent to the type of infection (acute or chronic), the biology of the virus and the immunological condition of the individual during the infection process because, as we observed in the findings of previous studies, the polymorphisms may be associated with different clinical outcomes. Although, in our study, the polymorphisms were related to changes in the levels of TLR7 expression and IFN-α production in HTLV-1 infection, did not directly influence the induction of disease symptoms, while the relationship of these polymorphisms with cases of serious illness is much stronger in other infections.
In our study, the HTLV-1 proviral load was greater in individuals with symptoms of disease than in asymptomatic individuals, although this difference was not statistically significant. However, the proviral load was not associated with the TLR7 rs179008 (A/T) or TLR7 rs3853839 (C/G) polymorphisms. The quantification of the proviral load is considered an important parameter for the evaluation of HTLV-1 infection (40). A greater proviral load is associated with the presence of disease symptoms, especially in HAM (41, 42), although some individuals without clinical symptoms of specific diseases associated with HTLV-1 may also present high proviral loads (40), suggesting that these individuals need constant medical monitoring to assess the onset of symptoms earlier. As HTLV-1 is detected by TLR7, the TLR7 rs3853839 (C/G) and TLR7 rs179008 (A/T) polymorphisms do not appear to be sufficient to influence antiviral activity and control virus replication when present in isolation.
Elevated TNF-α level were associated with the presence of symptoms of HTLV-1-related diseases in the bivariate analysis; however, this was not confirmed in the multivariate analysis. Although HTLV-1 induces inflammatory diseases such as HAM, which is associated with increased TNF-α levels (43), it is possible that this cytokine is more concentrated at the site of the inflammatory process, with lower detection at the systemic level. Other factors inherent to the individual’s physiological condition may contribute to variations in cytokine levels, such as obesity, since adipose tissue induces the production of TNF-α (44).
Multiple regression analysis revealed that the TLR7 rs3853839 (C/G) polymorphism was associated with increased TLR7 gene expression levels and increased IFN-α levels and that the TLR7 rs179008 (A/T) polymorphism was associated with reduced INF-α levels. The levels of the investigated markers were evaluated in relation to different combinations of alleles for the TLR7 rs3853839 (C/G) and TLR7 rs179008 (A/T) polymorphisms. In this analysis, IFN-α levels were significantly greater in individuals carrying the A/G allele, which is related to the preserved structure of the TLR7 receptor and higher TLR7 gene expression levels for the TLR7 rs179008 (A/T) and TLR7 rs3853839 polymorphisms (C/G), respectively. These same individuals also had lower HTLV-1 proviral loads, although the differences were not statistically significant. These results suggest an important relationship between the alleles that influence the gene expression and structure of TLR7 and HTLV-1 infection. Combinations of different alleles for variations in the TLR7 gene were associated with the evolution of viral infections. The combination of TTA alleles for the TLR7 polymorphisms rs179010 (C/T), rs2074109 (T/C) and rs179009 (A/G) was associated with reduced susceptibility to HIV-1 infection (17), while the CTA haplotype was associated with the progression of chronic hepatitis B (45). Our study showed that although the TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms do not allow differentiating the presence or absence of symptoms of HTLV-1-associated diseases, it is possible that the combination of A/G alleles to these polymorphisms may influence the antiviral response to the course of HTLV-1 infection.
Our study presents important information that may contribute to the context of personalized medicine, related to the prediction of prognosis of HTLV-1 infection, since mutations in TLR7 can influence the evolution of viral infections. However, the study has some limitations, including the number of polymorphisms evaluated. The study evaluated two polymorphisms in the TLR7 gene, but there are other genetic variations that need to be investigated in order to identify which ones may be contributing to better or worse control of HTLV-1 infection. Another limitation is related to cytokine levels. Several factors can influence systemic cytokine levels. The presence of infection is one of these main factors, although some conditions can contribute to variations in cytokine levels, such as obesity, age and smoking. Although HTLV-1 infection was present in both groups (symptomatic and asymptomatic) and the mean age of these groups was similar, individuals were not assessed for obesity and smoking habits. In summary, the TLR7 rs179008 (A/T) polymorphism was associated with reduced IFN-α levels, and the TLR7 rs3853839 (C/G) variation was associated with increased TLR7 gene expression and IFN-α levels. The polymorphisms were not associated with the presence of symptoms of HTLV-1-associated diseases; however, in combination, the A and G alleles for the TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms appear to be important in controlling HTLV-1 infection, as they have been shown to promote a greater antiviral response against HTLV-1 infection.
The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.
The studies involving humans were approved by National Research Ethics Committee (CAAE:63427822.3.0000.0018). The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.
ES: Writing – original draft, Investigation, Methodology, Resources. FF: Investigation, Methodology, Writing – original draft, Resources. WB: Methodology, Writing – original draft. FL: Writing – original draft, Methodology. AL: Methodology, Writing – original draft. GN: Methodology, Writing – original draft. EA: Investigation, Methodology, Writing – original draft. SL: Formal analysis, Writing – original draft. Cd: Methodology, Writing – original draft. MS: Methodology, Writing – original draft. RI: Investigation, Writing – review & editing. IC-V: Investigation, Writing – review & editing. AV: Funding acquisition, Investigation, Writing – review & editing. MQ: Conceptualization, Formal analysis, Funding acquisition, Project administration, Supervision, Writing – original draft, Writing – review & editing.
The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This study was supported by the National Council for Scientific and Technological Development (CNPq 304835/2022-6, 401569/2023-3. 302935/2021-5 and 303837/2023-3), INCT Theranostics and Nanobiotechnology (CNPq Process No. 403193/2022-2 and Fapemig: CBB - APQ-03613-17) and the National Institute of Science and Technology in Emerging and Reemerging Viruses (INCT-VER No. 406360/2022-7).
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2024.1462352/full#supplementary-material
1. Kalyanaraman VS, Sarngadharan MG, Nakao Y, Ito Y, Aoki T, Gallo RC. Natural antibodies to the structural core protein (p24) of the human T-cell leukemia (lymphoma) retrovirus found in sera of leukemia patients in Japan. Proc Natl Acad Sci. (1982) 79:1653–7. doi: 10.1073/pnas.79.5.1653
2. Osame M, Usuku K, Izumo S, Ijichi N, Amitani H, Igata A, et al. HTLV-I associated myelopathy, a new clinical entity. Lancet. (1986) 1:1031–2. doi: 10.1016/s0140-6736(86)91298-5
3. Legrand N, McGregor S, Bull R, Bajis S, Valencia BM, Ronnachit A, et al. Clinical and public health implications of human T-lymphotropic virus type 1 infection. Clin Microbiol Rev. (2022) 35:e0007821. doi: 10.1128/cmr.00078-21
4. Schierhout G, McGregor S, Gessain A, Einsiedel L, Martinello M, Kaldor J. Association between HTLV-1 infection and adverse health outcomes: a systematic review and meta-analysis of epidemiological studies. Lancet Infect Dis. (2020) 20:133–43. doi: 10.1016/S1473-3099(19)30402-5
5. Mosley AJ, Asquith B, Bangham CR. Cell-mediated immune response to human T-lymphotropic virus type I. Viral Immunol. (2005) 18:293–305. doi: 10.1089/vim.2005.18.293
6. Clauze A, Enose-Akahata Y, Jacobson S. T cell receptor repertoire analysis in HTLV-1-associated diseases. Front Immunol. (2022) 13:984274. doi: 10.3389/fimmu.2022.984274
7. Vallinoto ACR, Cayres-Vallinoto I, Freitas Queiroz MA, Ishak MOG, Ishak R. Influence of immunogenetic biomarkers in the clinical outcome of HTLV-1 infected persons. Viruses. (2019) 11:974. doi: 10.3390/v11110974
8. Queiroz MAF, Amoras EDSG, Moura TCF, da Costa CA, de Sousa MS, Lima SS, et al. The SAMHD1 rs6029941 (A/G) polymorphism seems to influence the HTLV-1 proviral load and IFN-alpha levels. Front Cell Infect Microbiol. (2020) 10:246. doi: 10.3389/fcimb.2020.00246
9. Brites C, Grassi MF, Quaresma JAS, Ishak R, Vallinoto ACR. Pathogenesis of HTLV-1 infection and progression biomarkers: An overview. Braz J Infect Dis. (2021) 25:101594. doi: 10.1016/j.bjid.2021.101594
10. Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol. (2001) 2:675–80. doi: 10.1038/90609
11. Duan T, Du Y, Xing C, Wang HY, Wang RF. Toll-like receptor signaling and its role in cell-mediated immunity. Front Immunol. (2022) 13:812774. doi: 10.3389/fimmu.2022.812774
12. Askar E, Ramadori G, Mihm S. Toll-like receptor 7 rs179008/Gln11Leu gene variants in chronic hepatitis C virus infection. J Med Virol. (2010) 82:1859–68. doi: 10.1002/jmv.21893
13. Kawai T, Ikegawa M, Ori D, Akira S. Decoding Toll-like receptors: Recent insights and perspectives in innate immunity. Immunity. (2024) 57:649–73. doi: 10.1016/j.immuni.2024.03.004
14. Fitzgerald KA, Kagan JC. Toll-like receptors and the control of immunity. Cell. (2020) 180:1044–66. doi: 10.1016/j.cell.2020.02.041
15. Kinpara S, Kijiyama M, Takamori A, Hasegawa A, Sasada A, Masuda T, et al. Interferon-α (IFN-α) suppresses HTLV-1 gene expression and cell cycling, while IFN-α combined with zidovudine induces p53 signaling and apoptosis in HTLV-1-infected cells. Retrovirology. (2013) 10:52. doi: 10.1186/1742-4690-10-52
16. Feng X, Ratner L. Human T-cell leukemia virus type 1 blunts signaling by interferon alpha. Virology. (2008) 374:210–6. doi: 10.1016/j.virol.2007
17. Lee J, Ou JJ. Hepatitis C virus and intracellular antiviral response. Curr Opin Virol. (2022) 52:244–49. doi: 10.1016/j.coviro.2021.12.010
18. Starling AL, Martins-Filho OA, Lambertucci JR, Labanca L, de Souza Pereira SR, Teixeira-Carvalho A, et al. Proviral load and the balance of serum cytokines in HTLV-1-asymptomatic infection and in HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Acta Trop. (2013) 125:75–81. doi: 10.1016/j.actatropica.2012.09.012
19. Rosa DV, Magno LA, Pereira NC, Romanelli LC, Albuquerque MR, Martins ML, et al. Plasma and cerebrospinal fluid levels of cytokines as disease markers of neurologic manifestation in long-term HTLV-1 infected individuals. biomark Med. (2018) 12:447–54. doi: 10.2217/bmm-2017-0313
20. Kircheis R, Planz O. The role of toll-like receptors (TLRs) and their related signaling pathways in viral infection and inflammation. Int J Mol Sci. (2023) 24:6701. doi: 10.3390/ijms24076701
21. dos Santos BP, Valverde JV, Rohr P, Monticielo OA, Brenol JC, Xavier RM, et al. TLR7/8/9 polymorphisms and their associations in systemic lupus erythematosus patients from southern Brazil. Lupus. (2012) 21:302–9. doi: 10.1177/0961203311425522
22. Zhang T, Zhu J, Su B, Cao L, Li Z, Wei H, et al. Effects of TLR7 polymorphisms on the susceptibility and progression of HIV-1 infection in chinese MSM population. Front Immunol. (2020) 11:589010. doi: 10.3389/fimmu.2020.589010
23. Oh DY, Baumann K, Hamouda O, Eckert JK, Neumann K, Kücherer C, et al. A frequent functional toll-like receptor 7 polymorphism is associated with accelerated HIV-1 disease progression. AIDS. (2009) 23:297–307. doi: 10.1097/QAD.0b013e32831fb540
24. Azar P, Mejía JE, Cenac C, Shaiykova A, Youness A, Laffont S, et al. TLR7 dosage polymorphism shapes interferogenesis and HIV-1 acute viremia in women. JCI Insight. (2020) 5:e136047. doi: 10.1172/jci.insight.136047
25. Sánchez-Luquez K, SChadock IC, Gonçalves CV, Tornatore M, Finger-Jardim F, Avila EC, et al. Impact of TLR7 and TLR9 polymorphisms on susceptibility to placental infections and pregnancy complications. J Reprod Immunol. (2021) 146:103342. doi: 10.1016/j.jri.2021.103342
26. Minashkin MM, Grigortsevich NY, Kamaeva AS, Barzanova VV, Traspov AA, Godkov MA, et al. The role of genetic factors in the development of acute respiratory viral infection COVID-19: predicting severe course and outcomes. Biomedicines. (2022) 10:549. doi: 10.3390/biomedicines10030549
27. Shen N, Fu Q, Deng Y, Qian X, Zhao J, Kaufman KM, et al. Sex-specific association of X-linked Toll-like receptor 7 (TLR7) with male systemic lupus erythematosus. Proc Natl Acad Sci U S A. (2010) 107:15838–43. doi: 10.1073/pnas.1001337107
28. Deng Y, Zhao J, Sakurai D, Kaufman KM, Edberg JC, Kimberly RP, et al. MicroRNA-3148 modulates allelic expression of toll-like receptor 7 variant associated with systemic lupus erythematosus. PloS Genet. (2013) 9:e1003336. doi: 10.1371/journal.pgen.1003336
29. Yue M, Feng L, Tang SD, Wang JJ, Xue XX, Ding WL, et al. Sex-specific association between X-linked Toll-like receptor 7 with the outcomes of hepatitis C virus infection. Gene. (2014) 48:244–50. doi: 10.1016/j.gene.2014.07.040
30. El-Hefnawy SM, Eid HA, Mostafa RG, Soliman SS, Omar TA, Azmy RM. COVID-19 susceptibility, severity, clinical outcome and Toll-like receptor (7) mRNA expression driven by TLR7 gene polymorphism (rs3853839) in middle-aged individuals without previous comorbidities. Gene Rep. (2022) 27:101612. doi: 10.1016/j.genrep.2022.101612
31. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. (2001) 25:402–8. doi: 10.1006/meth.2001.1262
32. Tamegão-Lopes BP, Rezende PR, Maradei-Pereira LM, de Lemos JA. Carga proviral do HTLV-1 e HTLV-2: um método simples através da PCR quantitativa em tempo real [HTLV-1 and HTLV-2 proviral load: a simple method using quantitative real-time PCR. Rev Soc Bras Med Trop. (2006) 39:548–52. doi: 10.1590/s0037-86822006000600007
33. Goodman LA. On methods for comparing contingency tables. J Roy Stat Soc: Ser A (General). (1963) 126:94–108. doi: 10.2307/2982447
34. Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science. (2004) 303:1529–31. doi: 10.1126/science.1093616
35. Li F, Li X, Zou GZ, Gao YF, Ye J. Association between TLR7 copy number variations and hepatitis B virus infection outcome in Chinese. World J Gastroenterol. (2017) 23:1602–7. doi: 10.3748/wjg.v23.i9.1602
36. Saha B, Kodys K, Adejumo A, Szabo G. Circulating and exosome-packaged hepatitis C single-stranded RNA induce monocyte differentiation via TLR7/8 to polarized macrophages and fibrocytes. J Immunol. (2017) 198:1974–84. doi: 10.4049/jimmunol.1600797
37. Lester RT, Yao XD, Ball TB, McKinnon LR, Kaul R, Wachihi C, et al. Toll-like receptor expression and responsiveness are increased in viraemic HIV-1 infection. AIDS. (2008) 22:685–94. doi: 10.1097/QAD.0b013e3282f4de35
38. Salvi V, Nguyen HO, Sozio F, Schioppa T, Gaudenzi C, Laffranchi M, et al. SARS-CoV-2-associated ssRNAs activate inflammation and immunity via TLR7/8. JCI Insight. (2021) 6:e150542. doi: 10.1172/jci.insight.150542
39. Zhang Y, Suo X, Zhang Y. Association of IL-13, S100B, and TLR-7 gene polymorphisms with enterovirus 71 infection in hand, foot, and mouth disease in China. Genet Test Mol Biomarkers. (2019) 23:188–96. doi: 10.1089/gtmb.2018.0239
40. Olavarria VN, Gomes Ado N, Kruschewsky Rde A, Galvão-Castro B, Grassi MF. Evolution of HTLV-1 proviral load in patients from Salvador, Brazil. Braz J Infect Dis. (2012) 16:357–60. doi: 10.1016/j.bjid.2012.06.022
41. Pineda MV, Bouzas MB, Remesar M, Fridman A, Remondegui C, Mammana L, et al. Relevance of HTLV-1 proviral load in asymptomatic and symptomatic patients living in endemic and non-endemic areas of Argentina. PloS One. (2019) 14:e0225596. doi: 10.1371/journal.pone.0225596
42. de-Mendoza C, Pérez L, Rando A, Reina G, Aguilera A, Benito R, et al. HTLV-1-associated myelopathy in Spain. J Clin Virol. (2023) 169:105619. doi: 10.1016/j.jcv.2023.105619
43. Neco HVPDC, Teixeira VGDS, da Trindade ACL, Magalhães PMR, de Lorena VMB, Castellano LRC, et al. Mediators go together: high production of CXCL9, CXCL10, IFN-γ, and TNF-α in HTLV-1-associated myelopathy/tropical spastic paraparesis. AIDS Res Hum Retroviruses. (2017) 33:1134–39. doi: 10.1089/AID.2016.0296
44. Xiao QZ, Zhu LJ, Fu ZY, Guo XR, Chi X. Obesity related microRNA 424 is regulated by TNF α in adipocytes. Mol Med Rep. (2021) 23:21. doi: 10.3892/mmr.2020.11659
Keywords: HTLV-I infection, toll-like receptor 7, polymorphism genetic, gene expression profile, interferon-alpha
Citation: Santana EGM, Ferreira FdS, Brito WRdS, Lopes FT, de Lima ACR, Neto GdSP, Amoras EdSG, Lima SS, da Costa CA, Souza MS, Ishak R, Cayres-Vallinoto IMV, Vallinoto ACR and Queiroz MAF (2024) TLR7 rs179008 (A/T) and TLR7 rs3853839 (C/G) polymorphisms are associated with variations in IFN-α levels in HTLV-1 infection. Front. Immunol. 15:1462352. doi: 10.3389/fimmu.2024.1462352
Received: 10 July 2024; Accepted: 01 November 2024;
Published: 22 November 2024.
Edited by:
Kyung-Hyun Park-Min, Hospital for Special Surgery, United StatesReviewed by:
Cristina Wide Pissetti, Federal University of Paraíba, BrazilCopyright © 2024 Santana, Ferreira, Brito, Lopes, de Lima, Neto, Amoras, Lima, da Costa, Souza, Ishak, Cayres-Vallinoto, Vallinoto and Queiroz. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Maria Alice Freitas Queiroz, YWxpY2VmYXJtYUBob3RtYWlsLmNvbS9hbGljZWZyZWl0YXNAdWZwYS5icg==
†These authors have contributed equally to this work
Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.
Research integrity at Frontiers
Learn more about the work of our research integrity team to safeguard the quality of each article we publish.