AUTHOR=Zhang Lily , Mao Xiao , Long Hongyu , Xiao Bo , Luo Zhaohui , Xiao Wenbiao , Jin Xingbing 

TITLE=Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia

JOURNAL=Frontiers in Genetics

VOLUME=11

YEAR=2020

URL=https://www.frontiersin.org/journals/genetics/articles/10.3389/fgene.2020.00564

DOI=10.3389/fgene.2020.00564

ISSN=1664-8021

ABSTRACT=<p>Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in <italic>PIGS</italic> (MIM:610271):c.148C &gt; T (p.Gln50<sup>∗</sup>) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with <italic>PIGS</italic> variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of <italic>PIGS</italic> gene in the case of pediatric neurological syndromes and reviews the clinical features of <italic>PIGS</italic>-associated disorders.</p>