Abstract
Large colon volvulus in horses is associated with a poor prognosis, especially when ischemic-reperfusion injury of the affected intestinal tract develops. Proteinase-activated receptor 2 (PAR2) plays an important role in the pathogenesis of inflammation in the gastrointestinal tract. The aim of this study was to evaluate the distribution and expression of PAR2 in colonic pelvic flexure of horses spontaneously affected by large colon volvulus (CVH group). Eight horses admitted for severe abdominal colon volvolus and which underwent surgery were included. Colon samples were collected after enterotomy. Data previously obtained from healthy horses were used as a control group. Histologic evaluation was carried out to grade the severity of the colon lesions. Immunofluorescence, western blot and quantitative polymerase chain reaction (RT-qPCR) were carried out on colon samples to evaluate PAR2 expression. In addition, the transcriptional profile of cytokines and chemokines was evaluated using RT2 Profilerâ„¢ PCR Array Horse Cytokines & Chemokines. Three out of the eight patients were euthanised due to clinical deterioration. Immunostaining for PAR2 was observed in the enterocytes, intestinal glands and neurons of the submucosal and myenteric plexi. In the CVH horses, the expression of PAR2 mesenger RNA (mRNA) did not differ significantly from that of the healthy animals; western blots of the mucosa of the colon tracts showed a clear band of the expected molecular weight for PAR2 (~44 kDa) and a band smaller than the expected molecular weight for PAR2 (25kDa), suggesting its activation. The gene expressions for C-X-C motif ligand 1 (CXCL1); interleukin 8 (IL8), macrophage inflammatory protein 2 beta (MIP-2BETA) were upregulated in the colic horses as compared with the colons of the healthy horses. Therefore, in the present study, the expression and activation of PAR2 in the colons of horses in the presence of an inflammatory reaction like that occurring in those with spontaneous colon volvulus was confirmed.
Introduction
Colic is the most frequent cause of death in horses, and large colon displacement and volvulus account for 10-20% of horses presented for colic (1). Weight of the large colon, its length, and its lack of extensive mesenteric attachments likely play a role in the development of malpositions (2).
The prognosis is often poor for ischaemic diseases of the colon, such as large colon volvulus and colonic infarction, despite aggressive surgical and medical interventions. The short-term survival rate for horses with large colon volvulus is high, ranging from 35 to 86% while the long-term survival rate decreases to ~30% (1, 3).
The onset time of volvulus, or strangulation of the colon, heart rate and packed cell volume (PCV) prior to admission were associated with patient survival to discharge. Moreover, an increase in heart rate in the postoperative period was associated with a poor outcome. A frequent cause of increase in heart rate is endotoxemia due to cellular damage of the mucosa, associated with reperfusion injury after the surgical reposition of the colon. At the cellular level, reperfusion of the ischemic tissue results in the rapid generation of oxygen-derived free radicals which overwhelms endogenous protective antioxidants and induces cell injury, particularly endothelial injury. Moreover, during reperfusion, the generation of reactive oxygen radicals, the production of proinflammatory enzymes, and the expression of adhesion molecules initiate an inflammatory response which enhances the release of proteinases generated by the immune cells (neutrophils, mast cells) (4) by means of the activation of the coagulation cascade (5).
Proteinase-activated receptor 2 (PAR2), a member of a family of G protein-coupled receptors, is largely distributed in the bowel tract, and it is activated by proteinases (such as trypsin and mast cell tryptase). These proteinases are particularly abundant in the guts of patients with inflammatory bowel disease (IBD) and in animal models with induced intestinal ischemia; therefore, the receptor is considered to play an important role in the pathogenesis of inflammation and related chronic pain in the gastrointestinal tract (6–8).
In the intestine, PAR2 signaling has been reported to both mediate physiological functions, e.g., ion transport, regulation of the intestinal barrier function and gut motility (9–12), and to exacerbate pathological conditions, such as tumor development and the progression of IBD or food sensitivities (8, 13–16). Due to the number of proteases involved and the multiple cell types affected, the selective regulation of intestinal PARs represents an interesting therapeutic strategy. The expression of PAR2 in the equine small intestine after epiploic foramen herniation has recently been described. The authors reported that PAR2 is strongly activated in the ischemic small intestine, internalized and progressively degraded in the bowel of horses with a diagnosis of an epiploic foramen hernia (17), confirming the key role of PAR2 in this spontaneous pathological model in the small intestine. The authors hypothesized that PAR2 could also play a role in the pathogenesis of colonic ischemic changes secondary to volvulus and treated with a surgical procedure.
The aim of this study was to evaluate the distribution and expression of PAR2 in the colonic pelvic flexure of horses spontaneously affected by large colon volvulus and to relate their expression to the presence of an inflammatory process.
Materials and Methods
The study was approved by the Ethical Scientific Committee for Experimental Animals of the University of Bologna (Prot. n 15-IX/, 08/ 05/2012).
Animals
Horses admitted to the Veterinary University Hospital (VUH) of the University of Bologna for severe abdominal pain and colon volvolus [colon volvulus horse (CVH) group], diagnosed during clinical evaluation at the VUH were recruited for the study.
In detail, the inclusion criteria were: >2 and <20 years of age, no sex distinction, presentation within 6 h of the onset of clinical signs of abdominal pain and a diagnosis of colon volvolus confirmed at exploratory laparotomy. Moreover, surgical inclusion criteria were applied: colon volvulus with a torsion >270° were included; horses with a diagnosis of nephrosplenic entrapment were excluded. To include a uniform population of horses having an ischemic process coming from a clinical recruitment, any horse in which the diagnosis was delayed at the VUH was excluded.
All patients underwent an exploratory laparotomy, and a tract of ~3 × 2 cm of pelvic flexure was resected by an experienced surgeon (AS) during a colotomy for the emptying of the left colon. The horse owners gave informed consent for inclusion in the study and committed to strictly following the rules of the experimental design.
Moreover, there was a control group composed of samples of pelvic flexure collected from eight healthy horses (HLT group) at the slaughterhouse, as previously described (18). Briefly, the horses were considered to be healthy based on clinicopathological and histological intestinal evaluation; there were five females and three geldings, of different breeds having a median age of 10.5 years (range 2–20).
Sample Collection
The blood samples undergoing clinicopathological evaluation were collected within 30 min from admission of the horses to the clinic. Tubes with K3EDTA anticoagulant, citrate and a clot activator were used. The blood samples were processed and analyzed within 1 h from collection, or were stored at −80°C.
A full thickness antimesenteric specimen from the pelvic flexure was taken immediately after the surgical evacuative colotomy. The specimen was dissected and separated into three small symmetric samples in a separate specific laboratory. After several washings with phosphate buffered saline (PBS, Gibco-Invitrogen, Paisley, UK), the intestinal mucosa from the first bioptic sample was scraped using two glass slides. All of the mucosa samples were then frozen in liquid nitrogen and stored at −80°C until RNA and protein extraction. The remaining two full-thickness samples were rinsed in PBS and immediately placed in 10% neutral buffered formalin (for histology) and 4% paraformaldehyde (for immunohistochemistry).
Clinicopathological Evaluation
All the cases included had a complete blood count (CBC) (ADVIA 2120, Siemens Healthcare Diagnostics, Tarrytown NY, USA) carried out, including haematocrit value (HCT), hemoglobin concentration, erythrocyte indices, platelet count, white blood cell (WBC) with differential WBC counts and a blood smear examination. A chemistry profile, including aspartate transaminase, lactate dehydrogenase (LDH), creatine kinase (CK), creatinine, urea, glucose, lactate, total bilirubin, γ-glutamyltransferase, total protein, albumin, total calcium, phosphorus, sodium, potassium, chloride, total iron, transferrin (as TIBC) and serum amyloid A (SAA), was carried out on the serum samples using an automated chemistry analyser (Olympus AU 400, Beckman Coulter/Olympus). Serum amyloid A was measured as previously reported (Dondi et al., 2015). Fibrinogen (Siemens), D-dimers (D-DI2 Tina-quant, Roche/Hitachi), and antithrombin (Antithrombin III, Roche/Hitachi) were also measured on plasma samples.
Histology
Tissue samples, fixed in 10% neutral buffered formalin, were embedded in paraffin within 24–48 h, cut into 5 μm-thick sections and stained with haematoxylin and eosin. The specimen size was standard (1.5 cm in length) and one tissue section from each sample was available for review. Eigth sections from 8 horses were assessed (one colonic tissue section for each horse). Tissue viability was determined by evaluating the morphological changes present in the tissue sections using the scoring system previously described (19, 20) on the basis of the grading of the following parameters: interstitial-crypt ratio (I:C; normal: <1), percentage loss of surface epithelial, percentage loss of the glandular epithelium (superficial and deep), percentage area of hemorrhage (lamina propria and submucosa), percentage area of edema (lamina propria and submucosa) and thrombosis. These criteria were each given a score from 1 to 5, leading to an overall cumulative score/section ranging from 10 to 50 (20). The cut-off between no lesions or lesions of mild severity, and serious necrotic/haemorrhagic injuries was 20 (0–5: no lesions; 6–19: lesions of mild severity, no necrosis; > 19 severe necrotic/haemorrhagic injury) (17).
Immunohistochemistry
The tissue was fixed for 48 h in 4% paraformaldehyde in 0.1 M PBS, pH 7.4, at 4°C. To obtain frozen tissue, small longitudinal portions (1 × 0.3 cm) of the cranial intestine were washed in PBS and stored at 4°C in PBS containing 30% sucrose and sodium azide (0.1%). On the following day, the tissues were placed in a mixture of PBS−30% sucrose azide and Optimal Cutting Temperature (OCT) compound (Sakura Finetek Europe, NL) at a ratio of 1:1 for an additional 24 h before being embedded in 100% OCT in Cryomold® (Sakura Finetek, Zoeterwoude, NL, Europe). The sections were prepared by freezing tissues in isopentane cooled in liquid nitrogen. Serial longitudinal sections (14–16 μm thickness) of the tissues were cut on a cryostat (Leica, Wetzlar, Germany) and mounted on polysine-coated slides. The sections were stored at −80°C until the histological and/or immunohistochemical experiments were begun. Six sections for each animal were prepared.
Single Immunofluorescence Experiments
The cryostat sections were rehydrated in PBS and were then processed for immunostaining. To block non-specific binding, the sections were incubated in a solution containing 10% normal goat serum (Colorado Serum Co., Denver, CO, #CS 0922) and 0.5% Triton X-100 (Merck, Darmstadt) in PBS for 1 h at room temperature (RT). Thereafter, the sections were incubated in primary antibody rabbit anti-PAR2 (1:100, Santa Cruz Biotechnology, Santa Cruz, Dallas, TX, USA, Cat# sc-5597, RRID:AB_2231455) diluted in antibody diluent (1.8% NaCl in 0.01 M sodium phosphate buffer containing 0.1% sodium azide) for 24 h at +4°C. After washing in PBS (3 × 10 min), the sections were incubated in secondary antibody goat anti-Rabbit (1:400, Alexa Fluor 594, Thermo Fisher Scientific, Waltham, MA, USA, Cat# A-11037, RRID:AB_2534095) diluted in PBS for 1 h at RT. After washing in PBS (3 × 10 min), the slides were coverslipped with buffered glycerol (pH 8.6). Primary and secondary antobody solutions contained normal goat serum (10%) and Triton X-100 (0.5%). All the incubations were carried out in a humid chamber. The anti-PAR2 antibody utilized in this study was tested for its specificity by Western blot analysis which indicated that it was specific for the targeted molecules. The omission as well as the replacment of the secondary antibodies with inappropriate secondary antibodies resulted in the elimination of all the immunoistochemical staining.
Double Immunofluorescence Experiments
The sections used for neuron assessments were incubated for 24 h at room temperature with a primary antibody solution containing rabbit anti-PAR2 (1:200, Santa Cruz Biotechnology, Cat# sc-5597, RRID:AB_2231455) and mouse anti-HuC/D (1:100, Molecular Probes, Eugene, OR, USA, Cat# A-21271, RRID:AB_221448). These sections were washed in PBS (3 × 10 min) and were then incubated with a secondary antibody solution containing Alexa Fluor 488-conjugated goat anti-mouse immunoglobulin G (IgG) (1:400, Molecular Probes, Cat# A-11029, RRID:AB_138404) and Alexa Fluor 594-conjugated goat anti-rabbit IgG (1:400, Molecular Probes, Cat# A-11012, RRID:AB_141359) in PBS. The slides were then washed in PBS (3 × 10 min) and were finally coverslipped with buffered glycerol (pH 8.6). The primary and secondary antibody solutions contained normal goat serum (10%) and Triton X-100 (0.5%).
Analysis of the Sections
The immunofluorescence preparations were observed using a Nikon H550L (Nikon Instruments, Japan) equipped with the appropriate filter cubes for immunofluorescence. The FITC filter for Alexa 488 (Ex 465–495; DM 505; BA 515–555) and the TRITC filter for Alexa 594 (EX 540/25; DM 565; BA 605–655) were used. For the double immunofluorescence analysis, the neurons were first located by the presence of a fluorophore which labeled one antigen; the filter was then switched to a fluorophore specific for a different wavelength to determine whether or not the neuron was labeled for a second antigen. The images were recorded using a Nikon-Qi1Mc photocamera (Nikon Instruments, Japan) and Nikon Elements Version 4.10 software. The contrast and brightness of the figures were adjusted to reflect the appearance of the labeling seen through the microscope using Adobe Photoshop CS3 Extended 10.0 software (Adobe Systems, San Jose, CA).
RNA Isolation and Quantitative Real Time Polymerase Chain Reaction (RT-qPCR) for PAR2
The RNA extraction and qPCR analysis were essentially carried out as reported in a previous study (18). Briefly, samples of scraped pelvic flexure mucosa were pulverized using a mortar and pestle, and liquid nitrogen; 25 mg of each sample were then lysed in Tissue Lyser TL (50 Hz for 5 min, 2 beads diameter 2 mm, Qiagen, Hilden, Germany). The total RNA extraction was carried out using NucleoSpin RNA II (Macherey Nagel, Duren, Germany) instructions. The RNA was spectrophotometrically (Denovix Inc. Wilmington, DE, USA) quantified (A260 nm), and its quality was determined by gel electrophoresis on 1% agarose. Subsequently, 1 μg of RNA was reverse-transcribed to cDNA using an iScript cDNA Synthesis Kit (Bio-Rad Laboratories Inc., Hercules, CA, USA) in a final volume of 20 μl. Real-time qPCR was carried out using a CFX 96 Real Time System (Bio-RAD Laboratories Inc., California, USA) and iTaq Universal SYBR Green Supermix (Bio-RAD Laboratories Inc., California, USA). All the samples were analyzed in duplicate (10 μl/well).
In addition to the RNA samples from the affected gastrointestinal tracts (CVH group), samples of large colon intestine (n = 8) collected from the healthy adult horses (HLT group) after slaughter were reanalysed using qPCR as described in a previous paper (17).
The PAR2 and reference genes (GAPDH; HPRT, and β- actin) primer sequences, expected PCR product lengths and the accession numbers in the National Center of Biotechnology Information (NCBI) database are shown in Table 1. Primers were designed using Beacon Designer 2.07 Software (Premier Biosoft International, Palo Alto, CA) and they were chosen according the subsequent specification: primers located on different exons, length 16-28 bp, avoid the secondary structure, 3' stability and specificity. The stability of the reference genes were evaluated by the Biogazelle's qbase plus software (include in the CFX 96 Real Time system). Real time efficiency curve for PAR2 was evaluated using pooled cDNA derived from healthy and pathological samples starting at 100 ng with 5 subsequent dilutions (20; 4; 0.8; 0.16; 0.032 ng) amplified in triplicate. The obtained curve data were: efficiency 84%, slope−3.776 and R2 0.971 including all samples with the largest variation on the most diluted one.
Table 1
| Gene | Sequence (5′-3′) | PCR length (bp) | AN |
|---|---|---|---|
| PAR-2 | For.: GGAAGGAGCCTCATTGGTAAG Rev.: ACAAGTGGAAGACAGACAGTAG | 140 | KF021489 |
| GAPDH | For.: TGGTGAAGGTCGGAGTAAAC Rev.: TGTAGTTGAGGTCAATGAAGGG | 120 | NM_001163856 |
| HPRT | For.: GCGTCGTGATTAGTGATGATGAAC Rev.: ACAGAGTGCTACAATGTGATGGC | 179 | AY372182 |
| β-ACTIN | For.: ATCGTGCGTGACATCAAGGA Rev.: AGGAAGGAGGGCTGGAAGAG | 169 | AF035774.1 |
Forward and reverse primer sequences, polymerase chain reaction (PCR) product lengths and accession numbers (AN) in the NCBI (National Center of Biotechnology Information) database.
The expression level of the PAR2 gene was determined using the 2 −ΔΔCt method (17) in which ΔCt = (Ct PAR2-Ct mean ref.genes) and ΔΔCt = ΔCt (CVH tract) - ΔCt (HLTtract).
PAR2 Western Blot Analysis
Protein extraction and Western blot analysis were essentially carried out as previously reported (18).
Aliquots containing 20 μg of proteins were separated on Bolt 4-12% bis-Tris Plusn (Thermo Fisher Scientific, Rockford, IL, USA) for 55 min at 165 V. The proteins were then electrophotoretically transferred onto a nitrocellulose membrane. The membranes were then incubated overnight at 4°C with a 1:500 dilution of the primary antibody, rabbit anti-PAR2 (Santa Cruz Biotechnology, Cat# sc-5597, RRID:AB_2231455), in Tris Buffered Saline-T20 (TBS-T20 20 mM: Tris-HCl, pH 7.4, 500 mM NaCl, 0.1% T-20) with 2% milk powder. After several washings with PBS-T20, the membranes were incubated with the secondary biotin-conjugate antibody (1:100.000 dilution in TBS-T20, 1 h at RT) and then with a 1:1000 dilution of an anti-biotin horseradish peroxidase (HRP)-linked antibody (1 h at RT). The intensity of the chemiluminescent signal of the resultant bands was acquired using the Chemidoc Instrument (Bio-Rad) and the bands were measured using LabImage Software (Bio-Rad).
In order to normalize the PAR2 data on the reference protein, the membranes were stripped (briefly: the membranes were washed for 5 min in water, then for 5 min in 0.2 M NaOH and were then washed again in water) and reprobed with the reference α-tubulin (1:500; cod.TU-01 Thermo Scientific Waltham, MA, USA). The relative PAR2 protein content was normalized to the value of the reference protein and was expressed as arbitrary units (AUs) for each healthy and pathological tract. The Western blots were developed using a chemiluminescent substrate (Clarity ECL Western Blot Substrate, Bio Rad) according to the manufacturer's instructions. The intensity of the luminescent signal of the resultant bands was acquired by Chemi Doc Instrument (Bio-Rad) using LabImage Software (Bio-Rad). The relative PAR2 protein content was normalized on the mean value of the reference protein and was expressed as AUs.
In addition to the samples derived from displaced colon, the proteins of the small intestines collected from the healthy adult horses after slaughter and described in a previous paper (18) were analyzed.
RT2 Cytokine Array
To evaluate the expression of the key molecules involved in the inflammatory response, a focused panel of equine cytokine and chemokine genes (RT2 Profilerâ„¢ PCR Array Horse Cytokines & Chemokines, Cat. No. 330231, PAEC-011ZA, Qiagen, Hilden, Germany) was used.
Total RNA from the healthy or the pathological tracts of the large colon was purified and quantified as previously mentioned above. Subsequently, one microgram of RNA pooled from a healthy or a pathological animal was retro-transcribed, using an RT2 First Strand Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions, in a 20 μl final volume to obtain the cDNA. RT2 Profiler™ PCR Array Horse Cytokines & Chemokines was carried out according to the manufacturer's instructions, using CFX 96 Touch (Bio-Rad Laboratories, Hercules, CA).
In order to validate the Array results, real time qPCR was carried out for those genes upregulated more than 10 times (IL-8; MIP2-Beta; CXCL1) with respect to the healthy sample. A master mix of the following reaction components was prepared in a 25 μl final volume using RT2 SYBR green master mix and RT2 Primer Assay (RT2 qPCR Primer Assay for Horse IL8, MIP2-beta; CXCL1, Cat. No. PPE00415B, PPE02633A; PPE00308; respectively, Qiagen) according to the manufacturer's instructions. One microliter of cDNA was added to 24 μl of the master mix. All the samples were analyzed in duplicate. The qPCR protocol used was: 10 min at 95°C, 40 cycles at 95°C for 15 s and at 60°C for 30 s, followed by a melting step from 55°C to 95°C (80 cycles of 0.5°C increase/cycle). The gene expression was evaluated using the ΔCt method (mean reference gene Ct GAPDH;HPRT, β−Actin-interest gene Ct). The relative messenger RNA (mRNA) expression of the genes tested was calculated in relation to the control cells using the 2−ΔΔct method (21).
Statistical Analysis
The clinicopathological data were reported as median and range (minimum-maximum). The mRNA and protein data of the HLT and the CVH groups were evaluated using student's t-test (p < 0.05) (GraphPad Prism V.5.01, GraphPad Software, La Jolla, CA, USA).
Results
Animals
Eight horses (5 females, 2 geldings and one stallion) having a mean age of 15 ± 6 years met the inclusion criteria and were enrolled in the study (CVH group). All the patients underwent an exploratory laparotomy, and a diagnosis of large colon volvolus was confirmed.
During the surgical procedure, a pelvic flexure colotomy was performed to remove all the fecal material, and repositioning of the large colon was subsequently carried out.
The postoperative period of all the patients was followed at the VUH. The horses received the specific therapy for postoperative large colon colic horses: fluid therapy (Ringer lactate 4–10 ml/kg/h), antibiotic therapy (ampicillin 20 mg/kg IV every 8 h; gentamicin 6.6 mg/kg every 24 h) and a prokinetic (intrastigmine 0.02 mg/kg every 2 h until normal motility of the large colon was restored), antiflammatory drugs (flunixine meglumine 1 mg/kg IV twice a day) and an anticoagulant (calcium heparin 5000 UI/kg SC). Within 48 h after the surgical procedure, three horses developed severe abdominal pain with an increased heart rate (range 79-110 beat for minutes), and they were euthanised the following 24 h. Five out of the 8 horses were discharged 7–10 days after admission.
Clinicopathological Evaluation
The clinical pathological data are summarized in Table 2. An increase in CK, D-dimer and SAA concentrations was observed. No other hematological or biochemical alterations were recorded.
Table 2
| Variable | Unit | Result | Reference interval |
|---|---|---|---|
| Hematology | |||
| Haematocrit value | % | 41.8 ± 15.1 | 31.5–50 |
| Hemoglobin | g% | 13.5 ± 3.40 | 11.0–19.0 |
| RBCs | 103 × Cells/mm3 | 8,753 ± 3,181 | 5,500–12,500 |
| WBCs | Cells/mm3 | 7,316 ± 2,831 | 5,000–13,000 |
| Platelets | Cells/mm3 | 104,375 ± 35,633 | 100,000–600,000 |
| Chemistry | |||
| AST | U/L | 219 (123–1626) | 60–280 |
| CK | U/L | 703 (47–1743) | 90–270 |
| LDH | U/L | 756 (338–2196) | 240–970 |
| Glucose | mg/dL | 145 (105–177) | 80–120 |
| Urea | mg/dL | 39 (33–78) | 15–40 |
| Creatinine | mg/dL | 1.35 (1.3–3.69) | 0.90–1.50 |
| Phosphate | mg/dL | 3.8 (2.5–5.27) | 1.75–4.90 |
| Total calcium | mg/dL | 9.25 (6.2–10.6) | 11.3–13.5 |
| Sodium | mEq/L | 138 (132–154) | 135–143 |
| Potassium | mEq/L | 3.5 (3.2–4.2) | 2.8–4.5 |
| Chloride | mEq/L | 97 (90–108) | 98–104 |
| Magnesium | mg/dL | 1.33 ± 0.17 | 1–2.6 |
| Albumin | g/dL | 2.53 (1.37–2.92) | 2.90–3.70 |
| Total protein | g/dL | 4.86 (3.17–5.61) | 5.90–7.30 |
| A:G | g:g | 1.05 (0.76–1.32) | 0.7–1.3 |
| Total bilirubin | mg/dL | 2.53 (0.55–6.86) | 0.90–2.60 |
| GGT | U/L | 8.7 (2.1–116) | 3.6–20.6 |
| Total iron | μg/dL | 77 ± 46 | 55–260 |
| TIBC | μg/dL | 300 ± 96 | 305–420 |
| TIBC saturation | % | 27 ± 14 | 12–70 |
| SAA | μg/mL | 94 ± 138 | 0–10 |
| Coagulation | |||
| Antithrombin | % | 134 (68–191) | 140–230 |
| D-dimer | μg/dL | 2.28 (0.14–3.2) | 0.20–0.48 |
| Fibrinogen | g/L | 3.43 (1.58–5.07) | 1.60–4.10 |
Clinicopathological values of the horses included in the study at admission.
Data are reported as mean±standard deviation or median and (minimum-maximum), based on their distribution.
RBCs, red blood cells; WBCs, white blood cells; AST, aspartate-aminotransferase; CK, Creatine-kinase; LDH, Lactate-dehydrogenase; A:G, Albumin to globulin ratio; GGT, Gamma-glutamyl-transferase; TIBC, Total iron binding capacity; SAA, Serum amyloid A.
Histology
In the colonic samples of the eight horses evaluated, the score ranged from 11 to 20; 6 samples were not necrotic, having lesions of mild severity (ranging from 11 to 15–Figure 1A) and 2 sections were necrotic (score equal to 20-Figure 1B). The histomorphological score system data are summarized in Table 3. The inflammatory infiltrate was mainly chronically moderate diffuse lymphoplasmcellular (in 6 out of 8 sections) and, in two samples, there was also the compresence of a small number of neutrophils and a moderate number of eosinophilic granulocytes. In the remaining 2 samples, however, the infiltrate was represented almost exclusively by large numbers of neutrophils and eosinophilic granulocytes.
Figure 1
Table 3
| Horse | Interstitial- crypt (I:C) ratio (normal: <1) | Surface epithelium loss* | Glandular epithelium loss* | Areas of hemorrhages* | Areas of oedema* | Thrombosis° | Total Score | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| S | D | LP | SM | LP | SM | LP | SM | ||||
| CVH1 | 3 | 4 | 3 | 2 | 1 | 2 | 2 | 1 | 1 | 1 | 20 |
| CVH2 | 1 | 2 | 1 | 1 | 2 | 2 | 2 | 2 | 1 | 1 | 15 |
| CVH3 | 2 | 1 | 1 | 1 | 1 | 2 | 1 | 2 | 1 | 1 | 13 |
| CVH4 | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 2 | 1 | 2 | 14 |
| CVH5 | 2 | 2 | 1 | 1 | 3 | 3 | 2 | 2 | 1 | 3 | 20 |
| CVH6 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 1 | 1 | 11 |
| CVH7 | 2 | 1 | 1 | 1 | 1 | 2 | 1 | 1 | 1 | 1 | 12 |
| CVH8 | 1 | 1 | 1 | 1 | 1 | 2 | 1 | 1 | 1 | 1 | 11 |
Results of the histomorphologic scoring system evaluation of the tissue sections included in the study.
Immunofluorescence Experiments
Strong PAR2 immunostaining was observed in the enterocytes (Figure 2A) and the intestinal glands (Figures 2B–E). Weak immunostaining could also occasionally be observed in the smooth muscle cells located in the muscularis mucosae (Figure 2F) and muscular layer (Figure 2G); PAR2 immunoreactivity was also observed in many neurons of the submucosal (Figures 2H,I) and the myenteric (Figures 2J,K) plexi.
Figure 2
RNA Isolation and RT- qPCR for PAR2
Quantitative PCR data demonstrated that PAR2 mRNA was detectable in all of the samples analyzed. No significant statistical difference of its expression in the pelvic flexure tracts was observed between the healthy (HLT) and the pathological (CVH) groups (Figure 3).
Figure 3
PAR2 Western Blot Analysis
Under denaturing gel electrophoresis conditions (SDS–PAGE), western blots of the mucosa of the colon tracts showed a clear band of the expected molecular weight for PAR2 (~44 kDa) and a smaller band (about 25kDa), suggesting an internalization and degradation of the receptor after its activation (17) (Figure 4).
Figure 4
The protein quantification of PAR2 showed a statistically significant reduction of the receptor (band of 44kDa) together with a statistically significant increase in the amount of the smaller band (25kDa) in relation to control tissue (Figure 5) in agreement with the mechanism of activation, internalization and degradation of the receptor.
Figure 5
RT2 Cytokine Array
Large Colon volvulus showed an altered gene expression profile; of the 84 genes of the RT2 Profilerâ„¢ PCR Array Horse Cytokines & Chemokines, 33 genes were upregulated (fold of change >1), 21 genes were downregulated (fold of change <1) and 29 were undetectable (ND) (Table 4). Three genes (CXCL1; IL8, MIP-2BETA) were upregulated more than 10-fold (Table 4) and the array on these three genes was verified. The array validation confirmed the gene expression profile determined by the array analysis (Figure 6); the Authors observed a significant increase in their expression in the pathological samples in relation to the healthy colons.
Table 4
| Gene | Fold change | Gene | Fold change | Gene | Fold change | Gene | Fold change |
|---|---|---|---|---|---|---|---|
| BMP2 | 1.22 | IL15 | 1.33 | MIF | 1.27 | OSM | ND |
| CCL11 | 1.81 | IL16 | 0.71 | CD40LG | 1.02 | TNFSF10 | 0.80 |
| CCL13 | 3.50 | IL17A | ND | FLT3LG | 0.80 | CD70 | 1.04 |
| CCL2 | 5.72 | IL18 | 1.34 | IL24 | ND | C5 | 1.75 |
| CCL3 | ND | IL18R1 | ND | CCL4 | 1.63 | CX3CR1 | ND |
| CCL5 | 0.64 | IL1A | 3.22 | LTA | ND | IL17F | ND |
| CCL8 | ND | IL1B | 4.98 | LTB | 0.82 | IL2RB | 0.46 |
| CCR2 | ND | IL1R1 | 2.46 | IL7R | 0.70 | IL10RA | ND |
| CCR5 | 1.01 | IL1RN | 2.12 | AIMP2 | ND | CSF1 | 0.80 |
| CSF3 | ND | IL23A | 0.90 | NAMPT | 1.48 | LIF | 0.72 |
| CXCL1 | 15.10 | IL4 | 0.56 | IL33 | 0.45 | CXCL11 | 0.56 |
| CXCL10 | 1.69 | IL4R | 1.23 | IL5RA | 0.83 | CCL20 | 0.85 |
| CXCL2 | 6.76 | IL5 | ND | TNFSF11 | ND | CXCL13 | 0.89 |
| CXCL6 | 5.80 | IL6 | ND | TNFSF14 | 0.51 | IL3 | ND |
| CXCL9 | 1.23 | IL6ST | 3.20 | IL17B | ND | PF4 | ND |
| FASLG | 0.86 | IL7R | 1.50 | TNFSF4 | ND | MIP-2BETA | 11.05 |
| GM-CSF | 0.67 | IL8 | 161.57 | CCL24 | 1.23 | TNF | 0.80 |
| IFNG | 0.21 | IL9R | ND | CCL22 | ND | TNFRSF11B | ND |
| IL10 | 0.53 | TGFB2 | 2.56 | IL9 | ND | TNFSF13 | 1.11 |
| IL12B | ND | IL17C | ND | EBI3 | ND | TNFSF13B | 1.62 |
| IL-13 | ND | IL10RB | 1.08 | IL21 | ND | VEGFA | 1.03 |
Transcriptional profile of the cytokines and chemokines in the large colon of the horses with large colon displacement and volvulus; 84 genes of the RT2 Profilerâ„¢ PCR Array Horse Cytokines & Chemokines were reported.
The relative messenger RNA (mRNA) expression (fold of change) of the tested genes was calculated in relation to the large colons of the healthy horses using the 2−ΔΔct method.
Figure 6
Discussion
In this paper, the Authors reported the distribution of the PAR2 at the level of the pelvic flexure in horses with volvolus of the large colon. In all the patients, the diagnosis was confirmed at explorative laparotomy; the histological evaluation allowed grading the severity of the colon lesions. Three out of the eight patients were euthanised due to clinical deterioration, and the survival outcome was 62.5%. Colon volvulus in horses is a frequent disease, causing colic syndrome; the short- and long-term survival outcomes vary from 35 to 57% (2, 22). The outcome is correlated primarily with the duration of the disease (23) and, after surgery, with the complications related to ischemia/reperfusion injury.
During colon volvulus, the damage to the vessels could result in ischemia. Later on, when the repositioning of the large colon occurs, reperfusion and re-oxygenation exacerbate the tissue injury (4, 24). In particular, ischemia and reperfusion induce the activation of an inflammatory response mediated by the migration of white blood cells into the lamina propria of the large intestine (24).
Of the clinicopathological parameters evaluated in the present cohort, an increase in SAA was recorded, confirming a severe inflammatory pathway, as has previously been described in colic horses (25, 26). The inflammatory activity was also confirmed in bioptic samples of the colon by the significant increase in the expression of cytokines, in particular of IL-8 and CXCL1, as has already been reported in human patients with chronic bowel inflammation (27, 28).
Proteinase activated receptor 2 modulates acute and chronic inflammatory processes in the gastrointestinal tract in both humans and animal models. In these situations, the PAR2 in the gastrointestinal tract acts as a pro-inflammatory mediator (29–31), or promotes cellular healing and maintains gastrointestinal motility (30, 32). These effects of PAR2 depend on the type of cells involved and are mediated by endogenous or exogenous proteases, but also by cytokine production and by enteric nervous system activation (16, 30, 33–36).
In the present study, PAR2 expression was identified in the enterocytes, in the intestinal glands, in the muscular layers of the muscolaris mucosae, in the enteric nervous system neurons and in the muscular layers. This same expression had previously been observed in the bowels of healthy horses and in the jejunums of colic horses (17, 18). In the present study the PAR2 mRNA expression in the samples collected from the colic horses did not differ significantly from that obtained in the samples collected from the healthy animals. Similarly, in the jejunums of horses with epiploic hernias, the PAR2 mRNA expression in the central injured tract, which was the intestinal tract characterized by severe histological lesions, did not differ significantly from that of the non-pathological jejunum samples (17). In previous studies, in animal models of ischemia and reperfusion injury, the PAR2 expression in the intestine did not differ if reperfusion occurred or not after the induced ischemic damage (30); in another study the PAR2 expression increased in a time dependent manner after intestinal injury and after 60 min of reperfusion (35). These differences could be explained by the different study designs. Yoshida and colleagues (35) simulated the ischemic damage by clamping both the superior mesenteric artery and the celiac trunk for 30 min. In the present study, the Authors included horses with colon volvulus, as a model of spontaneous inflammatory injury of the large intestine. All these horses were referred to the VUH within 6 h from the presentation of the clinical signs, but it was impossible to clearly define the exact time of the onset of the ischemia.
The protein quantification of PAR2 in the pathologic colon demonstrated a reduction in the amount of PAR2 protein (44kDa) and an increase in the amount of a light protein (25kDa) when compared with samples from healthy colon tracts. The same results were observed in small intestinal tracts following herniation through the epiploic foramen in which the PAR2 protein content was lower when compared with the samples of small intestines obtained from the control animals (17) and support the activation of PAR2. In fact, PAR2 activation consists of the cleavage of the extracellular N-terminal domain by the agonist proteinase. This results in the reduction of the protein level of the receptor and in the formation of an N-terminal peptide of a lower molecular weight. This peptide combines with the extracellular domain (tethered ligand) of the receptor itself, thereby activating the intracellular pathways (37).
Proteinase-activated receptor 2 activation is involved in the pathophysiology of gastrointestinal disease in several ways; of these, it modulates the tryptase induced IL-8 production by eosinophils (38), epithelial cells (36, 39), neutrophils (40) and endothelial cells (41). Even if in the present study, the interleukin-containing cells were not evaluated by immunohistochemistry, an involvement in PAR2 mediated interleukin production in the equine colon could be hypothesized as has previously been described in human colonic samples (28). In vitro studies showed that IL-8 production increased dose-dependently when PAR2 was activated while it was inhibited by a PAR2 antagonist (42–44).
CXCL1, IL-8 and MIP-2BETA are chemo-attractants for neutrophils (45, 46); MIP-2BETA is secreted by the epithelial cells during the inflammatory process of the intestinal tract (47). Moreover, the expressions of CXCL1 and IL-8 are reciprocally related; according to the data observed in the spontaneous equine acute models in the present study, both also increase in human patients during ulcerative colitis, a chronic inflammatory disease (28, 48). On the contrary, in PAR2 deficient mice, in which intestinal inflammation was experimentally induced with Toxoplasma gondii infection, the expression of CXCL1 was lower and the neutrophil infiltration was reduced when compared with wild type littermates (49).
In this study, the most important cellular infiltrates were represented by moderate-diffuse lympho-plasmacellular infiltrates and in only two intestinal section was the infiltrate represented almost exclusively by a large number of neutrophils. Neutrophils were observed in the sections of the two horses with the highest histological score. These cells play an important role in the mechanism leading to the mucosal damage associated with ischemia/reperfusion injury (50). This is related not only to the release of reactive oxygen metabolites and proteases by the neutrophils, but also to the physical alterations produced by their infiltration across the epithelium (50, 51).
The histological differences between ischemia and reperfusion in the equine colon were not evaluated in the present study; however, previous researchers have described the effects of experimentally induced colon ischemia and reperfusion in horses (4, 24). In detail, in the equine colon, the number of neutrophils in the mucosa increased after a brief period of ischemia, with progression after 1 h of reperfusion and peak infiltration after 2 h of reperfusion (4). However, in this latter study, despite the significant infiltration of neutrophils, epithelial repair was histologically evident after reperfusion (4). Therefore, Grosche et al. (4), observed that neutrophils might also play a role in the intestinal mucosa repair process when the ischemic damage is mild. In the present study, the neutrophil infiltration seemed to be related to severe damage of the tissue induced by the ischemic process and associated with a high histological score.
The samples obtained from the horses with the highest histological scores were also characterized by a large number of eosinophils. In previous studies, experimentally induced ischemia or naturally occurring colon volvulus did not change the total number of eosinophils; however, they appeared activated, and they migrated toward the luminal surface of the epithelium (4, 52, 53). These previous papers suggest that eosinophils also play a role in the ischemia and reperfusion mechanisms also in our cohort.
The inflammatory processes in the gastrointestinal tract are also modulated by the enteric nervous system by means of PAR2 (29) which is involved in neuronal signaling (54, 55). In fact, when the proteases activate PAR2 on the enteric neurons, they release neuropeptides resulting in a neurogenic inflammation characterized by vasodilation, edema and granulocyte infiltration (33). In the present study, immunostaining for PAR2 was observed in the myenteric and the submucosal plexi neurons, as has previously been observed in healthy horses (18). These results therefore additionally support the role of PAR2 in mediating ischemia/reperfusion injury in the equine colon.
The contribution of PAR2 in regulating the mechanisms involved in ischemia/reperfusion injury are still to be completely elucidated. However, experimental studies in animal models have demonstrated that the administration of a PAR2 antagonist attenuated the inflammation related to tissue damage (35, 56). In fact, in a rat model of reperfusion injury, when an anti-rat PAR2 cleavage site antibody was administered intraperitoneally before the ischemia, smaller erosions of the intestinal epithelial surface, fewer neutrophils and overall less extended intestinal damage was observed as compared with the untreated animals (35). Similarly, in a rat model of pancreatitis, anti-rat PAR2 cleavage site antibody administration determined the inhibition of cytokine production (56). Therefore, PAR2 should be taken into consideration in clinical activity, as a new therapeutic target, to modulate inflammatory changes related to ischemic colonic lesions and, maybe, to reduce the risk of postoperative complications such as ischemia/reperfusion injury.
Conclusions
In clinical practice, the manual repositioning of the displaced large colon is the resolving treatment for colon volvulus. However, the decision of the surgeon to remove the compromised tract still depends on the gross aspect of the mucosa.
In the present study the activation of the PAR2 in equine intestine with colon volvolus, as related with the tissue damage has been demonstrated. In addition, since in experimental model the administration of a PAR2 antagonist has been described as a promising therapy for modulation of inflammatory processes, further studies are warrented to evaluate if the administration of a PAR2 antagonist could be beneficial also in equine patients for the prevention of inflammatory-mediated intestinal damage secondary to ischemia or ischemia-reperfusion injury.
The limitation of the present study was the small number of animals included; however, the specific inclusion criteria allowed the Authors to include equines with comparable disease, especially in the time of onset of the large colon disease.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.
Ethics statement
The animal study was reviewed and approved by Ethical Scientific Committee for Experimental Animals of the University of Bologna (Prot. n 15-IX/, 08/ 05/2012). Written informed consent was obtained from the owners for the participation of their animals in this study.
Author contributions
CL, CBo, AZ, CBe, FD, MM, and MF carried out data management, analysis, and interpretation of the results. RR, AS, and NR carried out the sample collection. NR and CL wrote the first draft of the manuscript. CBo and AZ wrote sections of the manuscript. NR and AZ contributed to the conception and design of the study. All authors contributed to the manuscript revision and approved the version submitted.
Funding
This study was funded with grants provided by the University of Bologna; RFO-2018.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
- CVH
colon volvulus horse
- HLT
healthy horses
- IBD
inflammatory bowel diseases
- PAR
proteinase-activated receptor
- PBS
phosphate buffered saline
- qPCR
real time polymerase chain reaction
- RT
room temperature
- VUH
Veterinary University Hospital.
Abbreviations
References
1.
GonzalezLMFogleCABakerWTHughesFELawJMMotsinger-ReifAAet al. Operative factors associated with short-term outcome in horses with large colon volvulus: 47 cases from 2006 to 2013. Equine Vet J. (2015) 47:279–84. 10.1111/evj.12273
2.
JohnstonJKFreemanDE. Diseases and surgery of the large colon. Vet Clin North Am Equine Pract. (1997) 13:317–40. 10.1016/S0749-0739(17)30242-0
3.
SuthersJMPinchbeckGLProudmanCJArcherDC. Survival of horses following strangulating large colon volvulus. Equine Vet J. (2013) 45:219–23. 10.1111/j.2042-3306.2012.00620.x
4.
GroscheAMortonAJGrahamASValentineJFAbbottJRPolyakMMet al. Mucosal injury and inflammatory cells in response to brief ischaemia and reperfusion in the equine large colon. Equine Vet J Suppl. (2011) 16–25. 10.1111/j.2042-3306.2011.00415.x
5.
MonrealLCesariniC. Coagulopathies in horses with colic. Vet Clin North Am Equine Pract. (2009) 25:247–58. 10.1016/j.cveq.2009.04.001
6.
RaithelMWinterkampSPacurarAUlrichPHochbergerJHahnEG. Release of mast cell tryptase from human colorectal mucosa in inflammatory bowel disease. Scand J Gastroenterol. (2001) 36:174–9. 10.1080/003655201750065933
7.
GobbettiTCenacNMottaJPRollandCMartinLAndrade-GordonPet al. Serine protease inhibition reduces post-ischemic granulocyte recruitment in mouse intestine. Am J Pathol. (2012) 180:141–52. 10.1016/j.ajpath.2011.09.031
8.
Jimenez-VargasNNPattisonLAZhaoPLieuTLatorreRJensenDDet al. Protease-activated receptor-2 in endosomes signals persistent pain of irritable bowel syndrome. Proc Natl Acad Sci USA. (2018) 115:E7438–E47. 10.1073/pnas.1721891115
9.
VergnolleN. Clinical relevance of proteinase activated receptors (pars) in the gut. Gut. (2005) 54:867–74. 10.1136/gut.2004.048876
10.
MacNaughtonWK. Epithelial effects of proteinase-activated receptors in the gastrointestinal tract. Mem Inst Oswaldo Cruz. (2005) 100(Suppl 1):211–5. 10.1590/S0074-02762005000900036
11.
ZhangYGeTXiangPMaoHTangSLiAet al. Therapeutic effect of protease-activated receptor 2 agonist SLIGRL-NH2 on loperamide-induced Sprague-Dawley rat constipation model and the related mechanism. Drug Des Devel Ther. (2018) 12:2403–11. 10.2147/DDDT.S160628
12.
PontarolloGMannABrandãoIMalinarichFSchöpfMReinhardtC. Protease-activated receptor signaling in intestinal permeability regulation. FEBS J. (2020) 287:645–58. 10.1111/febs.15055
13.
VergnolleN. Review article: proteinase-activated receptors - novel signals for gastrointestinal pathophysiology. Aliment Pharmacol Ther. (2000) 14:257–66. 10.1046/j.1365-2036.2000.00690.x
14.
AmadesiSBunnettN. Protease-activated receptors: protease signaling in the gastrointestinal tract. Curr Opin Pharmacol. (2004) 4:551–56. 10.1016/j.coph.2004.08.004
15.
KawabataAMatsunamiMSekiguchiF. Gastrointestinal roles for proteinase-activated receptors in health and disease. Br J Pharmacol. (2008) 153(Suppl. 1):S230–40. 10.1038/sj.bjp.0707491
16.
CamineroAMcCarvilleJLGalipeauHJDeraisonCBernierSPConstanteMet al. Duodenal bacterial proteolytic activity determines sensitivity to dietary antigen through protease-activated receptor-2. Nat Commun. (2019) 10:1198. 10.1038/s41467-019-09037-9
17.
RomagnoliNZannoniABernardiniCGobbettiTBombardiCRambaldiAet al. Proteinase-activated receptor 2 distribution and expression in equine small intestine tracts following herniation through the epiploic foramen. Res Vet Sci. (2019) 125:434–40. 10.1016/j.rvsc.2017.10.006
18.
ZannoniABombardiCDondiFMoriniMForniMChiocchettiRet al. Proteinase-activated receptor 2 expression in the intestinal tract of the horse. Res Vet Sci. (2014) 96:464–71. 10.1016/j.rvsc.2014.03.006
19.
Van HoogmoedLSnyderJRPascoeJROlanderH. Use of pelvic flexure biopsies to predict survival after large colon torsion in horses. Vet Surg. (2000) 29:572–7. 10.1053/jvet.2000.17836
20.
LeviOAffolterVKBenakJKassPHLe JeuneSS. Use of pelvic flexure biopsy scores to predict short-term survival after large colon volvulus. Vet Surg. (2012) 41:582–8. 10.1111/j.1532-950X.2012.00994.x
21.
LivakKJSchmittgenTD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. (2001) 25:402–8. 10.1006/meth.2001.1262
22.
DriscollNBaiaPFischerATBrauerTKlohnenA. Large colon resection and anastomosis in horses: 52 cases (1996-2006). Equine Vet J. (2008) 40:342–47. 10.2746/042516408X293529
23.
HackettESEmbertsonRMHopperSAWoodieJBRugglesAJ. Duration of disease influences survival to discharge of thoroughbred mares with surgically treated large colon volvulus. Equine Vet J. (2015) 47:650–4. 10.1111/evj.12358
24.
GroscheAMortonAJGrahamASPolyakMMFreemanDE. Effect of large colon ischemia and reperfusion on concentrations of calprotectin and other clinicopathologic variables in jugular and colonic venous blood in horses. Am J Vet Res. (2013) 74:1281–90. 10.2460/ajvr.74.10.1281
25.
VandenplasMLMooreJNBartonMHRousselAJCohenND. Concentrations of serum amyloid A and lipopolysaccharide-binding protein in horses with colic. Am J Vet Res. (2005) 66:1509–16. 10.2460/ajvr.2005.66.1509
26.
DondiFLukacsRMGentiliniFRinnovatiRSpadariARomagnoliN. Serum amyloid A, haptoglobin, and ferritin in horses with colic: association with common clinicopathological variables and short-term outcome. Vet J. (2015) 205:50–5. 10.1016/j.tvjl.2015.03.015
27.
MazzucchelliLHauserCZgraggenKWagnerHHessMLaissueJAet al. Expression of interleukin-8 gene in inflammatory bowel disease is related to the histological grade of active inflammation. Am J Pathol. (1994) 144:997–1007.
28.
EgestenAEliassonMOlinAIErjefältJSBjartellASangfeltPet al. The proinflammatory CXC-chemokines GRO-alpha/CXCL1 and MIG/CXCL9 are concomitantly expressed in ulcerative colitis and decrease during treatment with topical corticosteroids. Int J Colorectal Dis. (2007) 22:1421–7. 10.1007/s00384-007-0370-3
29.
VergnolleN. The enteric nervous system in inflammation and pain: the role of proteinase-activated receptors. Can J Gastroenterol. (2003) 17:589–92. 10.1155/2003/683731
30.
CattaruzzaFCenacNBarocelliEImpicciatoreMHyunEVergnolleNet al. Protective effect of proteinase-activated receptor 2 activation on motility impairment and tissue damage induced by intestinal ischemia/reperfusion in rodents. Am J Pathol. (2006) 169:177–88. 10.2353/ajpath.2006.051098
31.
ZhaoJHDongLShiHTWangZYShiHYDingH. The expression of protease-activated receptor 2 and 4 in the colon of irritable bowel syndrome patients. Dig Dis Sci. (2012) 57:58–64. 10.1007/s10620-011-1827-3
32.
IablokovVHirotaCLPeplowskiMARamachandranRMiharaKHollenbergMDet al. Proteinase-activated receptor 2 (PAR2) decreases apoptosis in colonic epithelial cells. J Biol Chem. (2014) 289:34366–77. 10.1074/jbc.M114.610485
33.
NguyenCCoelhoAMGradyEComptonSJWallaceJLHollenbergMDet al. Colitis induced by proteinase-activated receptor-2 agonists is mediated by a neurogenic mechanism. Can J Physiol Pharmacol. (2003) 81:920–7. 10.1139/y03-080
34.
YoshidaNYoshikawaT. Basic and translational research on proteinase-activated receptors: implication of proteinase/proteinase-activated receptor in gastrointestinal inflammation. J Pharmacol Sci. (2008) 108:415–21. 10.1254/jphs.08R31FM
35.
YoshidaNTakagiTIsozakiYSuzukiTIchikawaHYoshikawaT. Proinflammatory role of protease-activated receptor-2 in intestinal ischemia/reperfusion injury in rats. Mol Med Rep. (2011) 4:81–6. 10.3892/mmr.2010.386
36.
GhouzaliIAzharSBôle-FeysotCDucrottéPDéchelottePCoëffierM. Proteasome inhibitors exacerbate interleukin-8 production induced by protease-activated receptor 2 in intestinal epithelial cells. Cytokine. (2016) 86:41–6. 10.1016/j.cyto.2016.07.014
37.
OssovskayaVSBunnettNW. Protease-activated receptors: contribution to physiology and disease. Physiol Rev. (2004) 84:579–621. 10.1152/physrev.00028.2003
38.
TemkinVKantorBWegVHartmanMLLevi-SchafferF. Tryptase activates the mitogen-activated protein kinase/activator protein-1 pathway in human peripheral blood eosinophils, causing cytokine production and release. J Immunol. (2002) 169:2662–9. 10.4049/jimmunol.169.5.2662
39.
CairnsJAWallsAF. Mast cell tryptase is a mitogen for epithelial cells. Stimulation of IL-8 production and intercellular adhesion molecule-1 expression. J Immunol. (1996) 156:275–83.
40.
HowellsGLMaceyMGChinniCHouLFoxMTHarriottPet al. Proteinase-activated receptor-2: expression by human neutrophils. J Cell Sci. (1997) 110:881–7.
41.
ComptonSJCairnsJAHolgateSTWallsAF. Human mast cell tryptase stimulates the release of an IL-8-dependent neutrophil chemotactic activity from human umbilical vein endothelial cells (HUVEC). Clin Exp Immunol. (2000) 121:31–6. 10.1046/j.1365-2249.2000.01271.x
42.
HirotaYOsugaYHirataTHaradaMMorimotoCYoshinoOet al. Activation of protease-activated receptor 2 stimulates proliferation and interleukin (IL)-6 and IL-8 secretion of endometriotic stromal cells. Hum Reprod. (2005) 20:3547–53. 10.1093/humrep/dei255
43.
YoshidaNKatadaKHandaOTakagiTKokuraSNaitoYet al. Interleukin-8 production via protease-activated receptor 2 in human esophageal epithelial cells. Int J Mol Med. (2007) 19:335–40. 10.3892/ijmm.19.2.335
44.
KajikawaHYoshidaNKatadaKHirayamaFHandaOKokuraSet al. Helicobacter pylori activates gastric epithelial cells to produce interleukin-8 via protease-activated receptor 2. Digestion. (2007) 76:248–55. 10.1159/000113041
45.
OhtsukaYLeeJStammDSSandersonIR. MIP-2 secreted by epithelial cells increases neutrophil and lymphocyte recruitment in the mouse intestine. Gut. (2001) 49:526–33. 10.1136/gut.49.4.526
46.
SpehlmannMEDannSMHruzPHansonEMcColeDFEckmannL. CXCR2-dependent mucosal neutrophil influx protects against colitis-associated diarrhea caused by an attaching/effacing lesion-forming bacterial pathogen. J Immunol. (2009) 183:3332–43. 10.4049/jimmunol.0900600
47.
OhnoYLeeJFusunyanRDMacDermottRPSandersonIR. Macrophage inflammatory protein-2: chromosomal regulation in rat small intestinal epithelial cells. Proc Natl Acad Sci USA. (1997) 94:10279–84. 10.1073/pnas.94.19.10279
48.
UguccioniMGionchettiPRobbianiDFRizzelloFPeruzzoSCampieriMet al. Increased expression of IP-10, IL-8, MCP-1, and MCP-3 in ulcerative colitis. Am J Pathol. (1999) 155:331–6. 10.1016/S0002-9440(10)65128-0
49.
BonnartCFeuilletGVasseurVCenacNVergnolleNBlanchardN. Protease-activated receptor 2 contributes to toxoplasma gondii-mediated gut inflammation. Parasite Immunol. (2017) 39. 10.1111/pim.12489
50.
GayleJMBlikslagerATJonesSL. Role of neutrophils in intestinal mucosal injury. J Am Vet Med Assoc. (2000) 217:498–500. 10.2460/javma.2000.217.498
51.
BlikslagerATMoeserAJGookinJLJonesSLOdleJ. Restoration of barrier function in injured intestinal mucosa. Physiol Rev. (2007) 87:545–64. 10.1152/physrev.00012.2006
52.
GroscheAFreemanDEMortonAJPolyakMMMatyjaszekSA. Effects of ischemia and reperfusion on production of nitrotyrosine, activation of eosinophils, and apoptosis in the large colonic mucosa of horses. Am J Vet Res. (2012) 73:53–61. 10.2460/ajvr.73.1.53
53.
RöttingAKFreemanDEConstablePDEurellJAWalligMA. Effects of ischemia and reperfusion on eosinophilic accumulation and distribution in mucosa of equine jejunum and colon. Am J Vet Res. (2016) 77:534–9. 10.2460/ajvr.77.5.534
54.
GaoCLiuSHuHZGaoNKimGYXiaYet al. Serine proteases excite myenteric neurons through protease-activated receptors in guinea pig small intestine. Gastroenterology. (2002) 123:1554–64. 10.1053/gast.2002.36581
55.
MuellerKMichelKKruegerDDemirIECeyhanGOZellerFet al. Activity of protease-activated receptors in the human submucous plexus. Gastroenterology. (2011) 141:2088–97.e1. 10.1053/j.gastro.2011.08.034
56.
MaedaKHirotaMKimuraYIchiharaAOhmurayaMSugitaHet al. Proinflammatory role of trypsin and protease-activated receptor-2 in a rat model of acute pancreatitis. Pancreas. (2005) 31:54–62. 10.1097/01.mpa.0000163178.37050.0d
Summary
Keywords
colic, colon volvolus, cytokines, equine, intestine, proteinase-activated receptor 2
Citation
Lambertini C, Zannoni A, Romagnoli N, Bombardi C, Morini M, Dondi F, Bernardini C, Forni M, Rinnovati R and Spadari A (2020) Expression of Proteinase-Activated Receptor 2 During Colon Volvulus in the Horse. Front. Vet. Sci. 7:589367. doi: 10.3389/fvets.2020.589367
Received
30 July 2020
Accepted
27 October 2020
Published
27 November 2020
Volume
7 - 2020
Edited by
Gustavo A. RamÃrez Rivero, Universitat de Lleida, Spain
Reviewed by
Katia Cappelli, University of Perugia, Italy; Jéssica MolÃn, Universitat de Lleida, Spain
Updates
Copyright
© 2020 Lambertini, Zannoni, Romagnoli, Bombardi, Morini, Dondi, Bernardini, Forni, Rinnovati and Spadari.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Noemi Romagnoli noemi.romagnoli@unibo.it
This article was submitted to Veterinary Experimental and Diagnostic Pathology, a section of the journal Frontiers in Veterinary Science
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.