ORIGINAL RESEARCH article

Front. Plant Sci., 18 January 2021

Sec. Plant Pathogen Interactions

Volume 11 - 2020 | https://doi.org/10.3389/fpls.2020.613499

Etiology of Cyclocarya paliurus Anthracnose in Jiangsu Province, China

  • Collaborative Innovation Center of Sustainable Forestry in Southern China, College of Forestry, Nanjing Forestry University, Nanjing, China

Abstract

Cyclocarya paliurus is an extremely valuable and multifunctional tree species whose leaves have traditionally been used in used in medicine or as a medicinal tea in China. In recent years, anthracnose has been frequently observed on young leaves of C. paliurus in several nurseries located in Jiangsu Province, resulting in great yield and quality losses. To date, no information is available about the prevalence of C. paliurus anthracnose in China. The main purpose of the present study was to characterize the etiology of C. paliurus anthracnose. Phylogenetic analysis of the eight-loci concatenated dataset revealed that all 44 single-spore Colletotrichum isolates belonged to three species in the Colletotrichum gloeosporioides species complex, namely, Colletotrichum aenigma, Colletotrichum fructicola, and C. gloeosporioides sensu stricto. Phenotypic features, including the colony appearance and the morphology of conidia, appressoria, and ascospores, were consistent with the phylogenetic grouping. Virulence tests validated that the three Colletotrichum species could cause typical symptoms of anthracnose on C. paliurus leaves, similar to those observed in the field. The optimum mycelial growth temperature ranged from 25 to 30°C for all representative isolates, while C. gloeosporioides s. s. isolates exhibited greater tolerance to high temperature (40°C). Fungicide sensitivity assays indicated that all three Colletotrichum species were sensitive to tetramycin, which may be a potential alternative for the management of C. paliurus anthracnose. To our knowledge, this study provides the first report of C. aenigma, C. fructicola, and C. gloeosporioides s. s. causing C. paliurus anthracnose in China as well as in the world.

Introduction

Cultivated for fine timber and as a medicinal plant, Cyclocarya paliurus is the sole extant species in the genus Cyclocarya and is native to China, naturally distributed in mountainous regions in the middle and lower reaches of the Yangtze River (Fang et al., 2011; Deng et al., 2015; Xie et al., 2015; Zheng et al., 2020). In Chinese folklore, C. paliurus is commonly called the “sweet tea tree,” and its leaves have traditionally been used as drug formulations for the treatment of obesity or diabetes mellitus (Fang et al., 2011; Cao et al., 2017; Xie et al., 2018). In recent years, increasing attention has been paid to C. paliurus because phytochemical studies have demonstrated that the extracts of its leaves possess a wide range of biological activities beneficial to human beings, such as antihypertensive (Xie et al., 2006), hypoglycemic (Wang et al., 2013), anti-HIV-1 (Zhang et al., 2010), antioxidant (Xie et al., 2010; Wang et al., 2013; Liu et al., 2018a, b), antitumor (Liu et al., 2018b), and anticancer (Xie et al., 2013) activities. Current focal studies of C. paliurus have concentrated on producing or identifying the bioactive components in its leaves. Unfortunately, to date, no information about C. paliurus anthracnose is available, and this disease could become a limiting factor affecting the C. paliurus tea industry.

The Coelomycetous genus Colletotrichum Corda includes plant pathogens responsible for anthracnose diseases with a global distribution (Hyde et al., 2009; Wikee et al., 2011; Cannon et al., 2012; Dean et al., 2012; He et al., 2019). From the perspective of economic and scientific importance, Colletotrichum was denoted the eighth most significant fungal phytopathogen group worldwide (Dean et al., 2012), attacking over 3200 dicot and monocot plant species (Manire et al., 2002; O’Connell et al., 2012). The morphological taxonomy of Colletotrichum species has historically been arduous owing to overlapping characteristics, and the morphology sometimes varies with environmental factors (e.g., temperature, illumination, etc.) in culture (Freeman et al., 1998; Cannon et al., 2012; Damm et al., 2019). Molecular tools have been widely applied to effectively identify and define fungi at the species level. In recent years, the majority of studies regarding anthracnose were conducted principally via morphology and multigene phylogeny based on modern taxonomic concepts, which provides a more precise and robust solution (Damm et al., 2012; Liu et al., 2014, 2015; De Silva et al., 2017a; Diao et al., 2017; Guarnaccia et al., 2017; Fu et al., 2019).

Colletotrichum spp. infections initially occur via the attachment of spores to the host plant surface, followed by spore germination and the formation of an appressorium, which penetrates the plant cuticle. This process suggests that appressoria and spores play a critical role in the infection cycle and that certain highly inhibitory substances against spore germination and appressorium production would be potential alternatives to control anthracnose (De Silva et al., 2017b; Gao et al., 2020; Konsue et al., 2020). Currently, chemical pesticides are identified as the principal agents used for anthracnose management (Bi et al., 2011). However, excessive use of such chemicals has also brought a series of challenges over time (Lu et al., 2010; Hu et al., 2015; Duan et al., 2018), including pathogen resistance and residual toxicity that affects human health and the environment (Kim et al., 2015; Alijani et al., 2019). The selection of environmentally safe, high-efficacy and relatively new fungicides is therefore imperative.

The application of antibiotic fungicides derived from metabolites of beneficial microbes to control phytopathogens has recently attracted increased attention since these compounds have been found to be environmentally friendly and may help to overcome pesticide resistance due to their low toxicity to non-target organisms and structural versatility (Moreira and May De Mio, 2015; Simionato et al., 2017; Han et al., 2020), offering a safe and effective way to circumvent the drawbacks of chemically synthesized pesticides and decreasing the environmental risks associated with their contamination (Ma et al., 2018a; Zhu et al., 2018).

Tetramycin, the fermentation metabolite of Streptomyces ahygroscopicus, exhibits excellent inhibitory activity against many plant pathogens, including Botrytis cinera, Passalora fulva, Phytophthora capsici, and Pyricularia oryzae (Zhong et al., 2010; Ren et al., 2014; Song et al., 2016; Chen L. L. et al., 2017; Ma et al., 2018a), which has been registered to manage rice and fruit crop diseases in China (Zhao et al., 2010). On the other hand, a previous study reported that tetramycin has the potential to elicit disease resistance by activating plant defensive enzymes, including polyphenol oxidase (PPO), peroxidase (POD), and phenylalanine ammonia lyase (PAL) (Zhong et al., 2010). Owing to its environmental friendliness and high efficiency, tetramycin has become the preferred fungicide in recent years (Song et al., 2016; Ma et al., 2018a, b).

Phenazine-1-carboxylic acid (PCA) is an important N-containing heterocyclic secondary metabolite (Zhu et al., 2019), which has been proved having antimicrobial (Palchykovska et al., 2012; Udumula et al., 2017), antitumorigenic (Gupta et al., 2014), antiviral, and antitubercular effects (Logua et al., 2009; Palchykovska et al., 2012), widely existed in microbial metabolites of Pseudomonads and Streptomycetes (Zhu et al., 2019). Particularly, in recent years, PCA received much attention due to outstanding inhibition effects against several phytopathogenic fungi in agricultural application (Zhu et al., 2019; Han et al., 2020). In China, PCA has been registered as the biofungicide “Shenqinbactin” for its environmental friendliness, low toxicity to human and animals, and the enhancement of crop production (Zhu et al., 2018, 2019; Han et al., 2020).

Kasugamycin, the fermentation product of Streptomyces kasugaensis, is a member of the aminoglycoside antibiotic (Uppala and Zhou, 2018). It was originally developed as a biofungicide for the management of rice blast caused by P. oryzae. Kasugamycin inhibits protein biosynthesis, with both fungicidal and bactericidal activities (McGhee and Sundin, 2011). Due to it is high efficiency and friendliness to environment, the use of Kasugamycin in United States has been approved by EPA for controlling diseases of several pome fruits in the past decade1.

In 2018, during an investigation of C. paliurus, serious anthracnose symptoms (Figure 1A) were observed in several nurseries located in the scientific research base of Nanjing Forestry University in Baima town (Baima), Nanjing. Over a half of the leaves were infected in Baima based on our observation. This anthracnose has been considered an emerging disease, but it is becoming endemic; nevertheless, the etiology, epidemiology, and management of this disease are uncertain. Hence, the objectives of the present study were to (1) accurately identify the Colletotrichum spp. causing C. paliurus anthracnose in Jiangsu Province, China, combining morphological and biological characteristics with molecular phylogenetic analyses; (2) examine the virulence of these fungi on C. paliurus leaves in vitro; and (3) characterize and compare the inhibitory effects of biofungicides against different Colletotrichum spp. in vitro.

FIGURE 1

Materials and Methods

Field Survey and Sampling

A field survey of C. paliurus anthracnose was carried out in Nanjing (five nurseries), Changzhou (four nurseries), and Yancheng (four nurseries) in September and October 2018 during the late growing season. Disease incidence was calculated as the percentage of trees displaying anthracnose symptoms out of the total number of evaluated trees (Bautista-Cruz et al., 2019). Three leaves exhibiting typical symptoms of anthracnose were randomly sampled per plant, and at least 10 symptomatic plants were sampled per nursery. All samples were then packaged in self-sealing bags and transported in an ice chest to the laboratory and then stored at 5°C prior to isolation.

Colletotrichum Isolation

To isolate the fungus, small sections (4-by-4 mm pieces) were removed from the margin of leaf lesions, surface disinfected in 1% (vol/vol) NaClO3 for 45 s and 75% ethanol for 30 s, rinsed in sterile distilled water three times, and air-dried on sterilized paper. The sections were then cultured onto 2% potato dextrose agar (PDA) (five sections per plate) amended with 100 μg/mL ampicillin to inhibit bacterial growth and incubated at 25°C in the dark. The emerging edges of the fungal mycelium were observed daily and transferred aseptically onto new PDA plates. Colonies similar in morphology to Colletotrichum spp. were purified using the monosporic isolation procedure described by Cai et al. (2009), and single-spore cultures were preserved in PDA slant test tubes at 4°C for follow-up studies. All isolates used in this study were deposit in State Key Laboratory of Forest Protection in Nanjing Forestry University.

Molecular Identification and Phylogenetic Analysis

For further characterization of the Colletotrichum spp., total genomic DNA (gDNA) of all single-spore isolates was extracted following the CTAB method described by Than et al. (2008). The concentrations of gDNA extracts were adjusted to 100 ng/μL with autoclaved double distilled water (ddH2O) using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Madison, WI, United States) and stored at −20°C before use. Polymerase chain reaction (PCR) amplification was performed for the following loci: the ITS region, calmodulin (CAL), β-tubulin (TUB), actin (ACT), chitin synthase 1 (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), glutamine synthetase (GS), and Apn2-Mat1-2 intergenic spacer (ApMat) genes. PCR amplifications were conducted in a 25 μL volume, mixed with 8.5 μL of ddH2O, 1 μL of each primer (10 μM), 2 μL of template DNA, and 12.5 μL of 2 × PCR Taq Master Mix (Applied Biological Materials Inc., Canada), using an Eppendorf Nexus Thermal Cycler (Germany). A negative control was added in all amplifications, where an equal volume of ddH2O replaced the template DNA. The primers and PCR settings for each locus are shown in Table 1. Amplification products were purified and sequenced by Jie Li Biotech Company (Shanghai, China). Forward and reverse DNA sequences were assembled and manually edited where necessary using Bioedit software (version 7.0.52), and the consensus sequences were deposited in GenBank (Table 2). Reference sequences from ex-type or other authoritative specimens of Colletotrichum spp. were retrieved from GenBank and aligned with sequences generated herein for constructing phylogenetic trees, with C. boninense (MAFF 305972) used as an outgroup (Tables 2, 3).

TABLE 1

SpeciesCulture/IsolateaHostCity/CountryGenBank accession numberb
ITSGAPDHCALACTCHS-1TUBGSApMat
C. aenigmaICMP 18608Persea americanaIsraelJX010244JX010044JX009683JX009443JX009774JX010389JX010078KM360143
HC3cCyclocarya paliurusChangzhou, ChinaMT476807MT501007MT500919MT500875MT500963MT501051MW344671MW344720
JS2C. paliurusChangzhou, ChinaMT476808MT501008MT500920MT500876MT500964MT501052MW344672MW344721
JS7C. paliurusChangzhou, ChinaMT476809MT501009MT500921MT500877MT500965MT501053MW344673MW344722
SC7cC. paliurusNanjing, ChinaMT476810MT501010MT500922MT500878MT500966MT501054MW344674MW344723
YM8cC. paliurusYancheng, ChinaMT476811MT501011MT500923MT500879MT500967MT501055MW344675MW344724
ZH2C. paliurusYancheng, ChinaMT476812MT501012MT500924MT500880MT500968MT501056MW344676MW344725
C. aeschynomenesICMP 17673Aeschynomene virginicaUnited StatesJX010176JX009930JX009721JX009483JX009799JX010392JX010081KM360145
C. alataeCBS 304.67, ICMP 17919Dioscorea alataIndiaJX010190JX009990JX009738JX009471JX009837JX010383JX010065KC888932
C. alienumICMP 12071Malus domesticaNew ZealandJX010251JX010028JX009654JX009572JX009882JX010411JX010101KM360144
C. aotearoaICMP 18537Coprosma sp.New ZealandJX010205JX010005JX009611JX009564JX009853JX010420JX010113KC888930
C. arecicolaCGMCC 3.19667, HNBL5Areca catechuWenchang, ChinaMK914635MK935455MK935374MK935541MK935498MK935413
C. asianumICMP 18580, CBS 130418Coffea arabicaThailandFJ972612JX010053FJ917506JX009584JX009867JX010406JX010096FR718814
C. boninenseMAFF 305972Crinum asiaticum var. sinicumJapanJX010292JX009905JQ005674JX009583JX009827JQ005588
C. clidemiaeICMP 18658Clidemia hirtaUnited States, HawaiiJX010265JX009989JX009645JX009537JX009877JX010438JX010129KC888929
C. cordylinicolaMFLUCC 090551, ICMP 18579Cordyline fruticosaThailandJX010226JX009975HM470238HM470235JX009864JX010440JX010122JQ899274
C. fructicolaICMP 18581, CBS 130416Coffea arabicaThailandJX010165JX010033FJ917508FJ907426JX009866JX010405JX010095JQ807838
BM5cC. paliurusNanjing, ChinaMT476813MT501013MT500925MT500881MT500969MT501057MW344677MW344726
BX1C. paliurusNanjing, ChinaMT476814MT501014MT500926MT500882MT500970MT501058MW344678MW344727
F5C. paliurusChangzhou, ChinaMT476815MT501015MT500927MT500883MT500971MT501059MW344679MW344728
GX1cC. paliurusChangzhou, ChinaMT476816MT501016MT500928MT500884MT500972MT501060MW344680MW344729
GT7C. paliurusChangzhou, ChinaMT476817MT501017MT500929MT500885MT500973MT501061MW344681MW344730
HC2cC. paliurusChangzhou, ChinaMT476818MT501018MT500930MT500886MT500974MT501062MW344682MW344731
HC6C. paliurusChangzhou, ChinaMT476819MT501019MT500931MT500887MT500975MT501063MW344683MW344732
JS3C. paliurusChangzhou, ChinaMT476820MT501020MT500932MT500888MT500976MT501064MW344684MW344733
JS9C. paliurusChangzhou, ChinaMT476821MT501021MT500933MT500889MT500977MT501065MW344685MW344734
LC7cC. paliurusNanjing, ChinaMT476822MT501022MT500934MT500890MT500978MT501066MW344686MW344735
LG2C. paliurusNanjing, ChinaMT476823MT501023MT500935MT500891MT500979MT501067MW344687MW344736
LG4C. paliurusNanjing, ChinaMT476824MT501024MT500936MT500892MT500980MT501068MW344688MW344737
LV2C. paliurusNanjing, ChinaMT476825MT501025MT500937MT500893MT500981MT501069MW344689MW344738
NC25cC. paliurusNanjing, ChinaMT476826MT501026MT500938MT500894MT500982MT501070MW344690MW344739
NC26C. paliurusNanjing, ChinaMT476827MT501027MT500939MT500895MT500983MT501071MW344691MW344740
PL2C. paliurusChangzhou, ChinaMT476828MT501028MT500940MT500896MT500984MT501072MW344692MW344741
PX3C. paliurusChangzhou, ChinaMT476829MT501029MT500941MT500897MT500985MT501073MW344693MW344742
SC6cC. paliurusNanjing, ChinaMT476830MT501030MT500942MT500898MT500986MT501074MW344694MW344743
SC9C. paliurusNanjing, ChinaMT476831MT501031MT500943MT500899MT500987MT501075MW344695MW344744
T5C. paliurusNanjing, ChinaMT476832MT501032MT500944MT500900MT500988MT501076MW344696MW344745
T9C. paliurusNanjing, ChinaMT476833MT501033MT500945MT500901MT500989MT501077MW344697MW344746
H3C. paliurusNanjing, ChinaMT476834MT501034MT500946MT500902MT500990MT501078MW344698MW344747
H4C. paliurusNanjing, ChinaMT476835MT501035MT500947MT500903MT500991MT501079MW344699MW344748
YH6cC. paliurusYancheng, ChinaMT476836MT501036MT500948MT500904MT500992MT501080MW344700MW344749
YH7C. paliurusYancheng, ChinaMT476837MT501037MT500949MT500905MT500993MT501081MW344701MW344750
YM2C. paliurusYancheng, ChinaMT476838MT501038MT500950MT500906MT500994MT501082MW344702MW344751
YM7C. paliurusYancheng, ChinaMT476839MT501039MT500951MT500907MT500995MT501083MW344703MW344752
ZH6C. paliurusYancheng, ChinaMT476840MT501040MT500952MT500908MT500996MT501084MW344704MW344753
C. gloeosporioidesIMI 356878, ICMP 17821, CBS 112999Citrus sinensisItalyJX010152JX010056JX009731JX009531JX009818JX010445JX010085JQ807843
BM6cC. paliurusNanjing, ChinaMT476841MT501041MT500953MT500909MT500997MT501085MW344705MW344754
F8C. paliurusChangzhou, ChinaMT476842MT501042MT500954MT500910MT500998MT501086MW344706MW344755
GX3cC. paliurusChangzhou, ChinaMT476843MT501043MT500955MT500911MT500999MT501087MW344707MW344756
JS1C. paliurusChangzhou, ChinaMT476844MT501044MT500956MT500912MT501000MT501088MW344708MW344757
JS5C. paliurusChangzhou, ChinaMT476845MT501045MT500957MT500913MT501001MT501089MW344709MW344758
LC2cC. paliurusNanjing, ChinaMT476846MT501046MT500958MT500914MT501002MT501090MW344710MW344759
LC6C. paliurusNanjing, ChinaMT476847MT501047MT500959MT500915MT501003MT501091MW344711MW344760
YM4cC. paliurusYancheng, ChinaMT476848MT501048MT500960MT500916MT501004MT501092MW344712MW344761
YM5C. paliurusYancheng, ChinaMT476849MT501049MT500961MT500917MT501005MT501093MW344713MW344762
ZH3C. paliurusYancheng, ChinaMT476850MT501050MT500962MT500918MT501006MT501094MW344714MW344763
C. horiiNBRC 7478, ICMP 10492Diospyros kakiJapanGQ329690GQ329681JX009604JX009438JX009752JX010450JX010137JQ807840
C. kahawae subsp. ciggaroICMP 18539Olea europaeaAustraliaJX010230JX009966JX009635JX009523JX009800JX010434JX010132
C. kahawae subsp. kahawaeIMI 319418, ICMP 17816Coffea arabicaKenyaJX010231JX010012JX009642JX009452JX009813JX010444JX010130JQ894579
C. ledongenseLD1683, CGMCC 3.18888Hevea brasiliensisHainan, ChinaMG242009MG242017MG242013MG242015MG242019MG242011MG242021
C. musaeCBS 116870, ICMP 19119Musa sp.United StatesJX010146JX010050JX009742JX009433JX009896HQ596280JX010103KC888926
C. noveboracenseAFKH109, CBS 146410Malus domesticaUnited StatesMN646685MN640567MN640566MN640565MN640569MN640568MN640564
C. nupharicolaICMP 18187, CBS:470.96Nuphar lutea subsp. polysepalaUnited StatesJX010187JX009972JX009663JX009437JX009835JX010398JX010088JX145319
C. perseaeGA100, CBS 141365Persea americanaIsraelKX620308KX620242KX620206KX620145KX620341KX620275KX620177
C. psidiiCBS 145.29, ICMP 19120Psidium sp.ItalyJX010219JX009967JX009743JX009515JX009901JX010443JX010133KC888931
C. queenslandicumICMP 1778Carica papayaAustraliaJX010276JX009934JX009691JX009447JX009899JX010414JX010104KC888928
C. salsolaeICMP 19051Salsola tragusHungaryJX010242JX009916JX009696JX009562JX009863JX010403JX010093KC888925
C. siamenseICMP 18578, CBS 130417Coffea arabicaThailandJX010171JX009924FJ917505FJ907423JX009865JX010404JX010094JQ899289
C. siamense (syn. C. hymenocallidis)CBS 125378, ICMP 18642Hymenocallis americanaChinaJX010278JX010019JX009709GQ856775GQ856730JX010410JX010100JQ899283
C. theobromicolaCBS 124945, ICMP 18649Theobroma cacaoPanamaJX010294JX010006JX009591JX009444JX009869JX010447JX010139KC790726
C. tiICMP 4832Cordyline sp.New ZealandJX010269JX009952JX009649JX009520JX009898JX010442JX010123KM360146
C. tropicaleCBS 124949, ICMP 18653Theobroma cacaoPanamaJX010264JX010007JX009719JX009489JX009870JX010407JX010097KC790728
C. xanthorrhoeaeBRIP 45094, ICMP 17903, CBS 127831Xanthorrhoea preissiiAustraliaJX010261JX009927JX009653JX009478JX009823JX010448JX010138KC790689

Descriptions and sequence accession numbers obtained from GenBank of the Colletotrichum spp. used in the phylogenetic study.

aCulture numbers in bold type represent ex-type or other authentic specimens. BRIP, Plant Pathology Herbarium, Department of Employment, Economic, Development and Innovation, Queensland, Australia; CBS, Culture collection of the Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Utrecht, Netherlands; ICMP, International Collection of Microorganisms from Plants, Auckland, New Zealand; IMI, Culture collection of CABI Europe UK Centre, Egham, United Kingdom; MAFF, MAFF Genebank Project, Ministry of Agriculture, Forestry and Fisheries, Tsukuba, Japan; MFLUCC, Mae Fah Luang University Culture Collection, ChiangRai, Thailand; NBRC, NITE Biological Resource Centre, Japan. MAFF 305972 (C. boninense) was added as an outgroup. bSequences in italics were generated in this study. ITS, internal transcribed spacers 1 and 2 together with 5.8S nrDNA; GAPDH, partial glyceraldehyde-3-phosphate dehydrogenase gene; CAL, partial calmodulin gene; ACT, partial actin gene; CHS-1, partial chitin synthase 1 gene; TUB2, partial beta-tubulin gene. cIsolates used for morphological and biological analysis, virulence tests, and biofungicide sensitivity assays.

TABLE 2

GeneProduct namePrimerDirectionSequence (5′-3′)PCR conditionsReferences
ITSInternal transcribed spacerITS1ForwardCTTGGTCATTTAGAGGAAGTAADenaturation for 4 min at 94°C, followed by 30 cycles; 30 s at 94°C, 30 s at 55°C, 30 s at 72°C, and a final extension of 10 min at 72°CGardes and Bruns, 1993
ITS4ReverseTCCTCCGCTTATTGATATGCWhite et al., 1990
GAPDHGlyceraldehyde-3-phosphate dehydrogenaseGDF1ForwardGCCGTCAACGACCCCTTCATTGADenaturation for 4 min at 94°C, followed by 30 cycles; 30 s at 94°C, 30 s at 60°C, 30 s at 72°C, and a final extension of 10 min at 72°CGuerber et al., 2003
GDR1ReverseGGGTGGAGTCGTACTTGAGCATGTGuerber et al., 2003
ACTActinACT-512FForwardATGTGCAAGGCCGGTTTCGCDenaturation for 4 min at 94°C, followed by 30 cycles; 30 s at 94°C, 30 s at 57°C, 30 s at 72°C, and a final extension of 10 min at 72°CCarbone and Kohn, 1999
ACT-783RReverseTACGAGTCCTTCTGGCCCATCarbone and Kohn, 1999
TUBβ-tubulinT1ForwardAACATGCGTGAGATTGTAAGTDenaturation for 4 min at 94°C, followed by 30 cycles; 30 s at 94°C, 30 s at 61°C, 30 s at 72°C, and a final extension of 10 min at 72°CO’Donnell and Cigelnik, 1997
Bt-2bReverseACCCTCAGTGTAGTGACCCTTGGCGlass and Donaldson, 1995
CALCalmodulinCL1AForwardGATCAAGGAGGCCTTCTCDenaturation for 4 min at 94°C, followed by 30 cycles; 30 s at 94°C, 30 s at 58°C, 30 s at 72°C, and a final extension of 10 min at 72°CO’Donnell et al., 2000
CL2AReverseTTTTTGCATCATGAGTTGGACO’Donnell et al., 2000
CHS-1Chitin synthase 1CHS-79FForwardTGGGGCAAGGATGCTTGGAAGAAGDenaturation for 4 min at 94°C, followed by 30 cycles; 30 s at 94°C, 30 s at 58°C, 30 s at 72°C, and a final extension of 10 min at 72°CCarbone and Kohn, 1999
CHS-354RReverseTGGAAGAACCATCTGTGAGAGTTGCarbone and Kohn, 1999
GSGlutamine synthetaseGSLF2ForwardTACACGAGSAAAAGGATACGCDenaturation for 4 min at 94°C, followed by 30 cycles; 30 s at 94°C, 30 s at 54°C, 30 s at 72°C, and a final extension of 10 min at 72°CLiu et al., 2016
GSLR1ReverseAGRCGCACATTGTCAGTATCGLiu et al., 2016
ApMatApn2-Mat1-2AM-FForwardTCATTCTACGTATGTGCCCGDenaturation for 3 min at 94°C, followed by 30 cycles; 45 s at 94°C, 45 s at 62°C, 1 min at 72°C, and a final extension of 7 min at 72°CSilva et al., 2012
AM-RReverseCCAGAAATACACCGAACTTGCSilva et al., 2012

Primers used in this study, with sequences, conditions and sources.

TABLE 3

Species/IsolateConidia
Appressoria
Ascospore
Length (μm)Width (μm)Length (μm)Width (μm)Length (μm)Width (μm)Shape
C. aenigma
HC318.58 ± 0.51ab (14.79–26.09)7.44 ± 0.17b (5.56–10.2)10.71 ± 0.25ab (8.35–13.68)7.48 ± 0.18f (5.85–9.56)18.4 ± 0.3bc (16.04–22.36)7.32 ± 0.14a (6.11–9.06)Cylindrical
SC718.82 ± 0.45ab (15.74–26.64)8.17 ± 0.23a (5.73–11.13)11.46 ± 0.42a (8.61–16.92)7.96 ± 0.25abcde (5.87–11.73)18.7 ± 0.24abc (16.91–21.94)7.44 ± 0.14a (6.01–8.85)Cylindrical
YM819.29 ± 0.43a (14.3–24.64)8.29 ± 0.17a (6.44–10.97)11.2 ± 0.24ab (9.6–14.34)7.53 ± 0.14ab (5.87–9.06)17.77 ± 0.16c (15.94–19.52)6.75 ± 0.15b (5.56–9.17)Cylindrical
C. fructicola
BM516.24 ± 0.24d (12–18.68)6.52 ± 0.17d (4.79–8.28)10.7 ± 0.21ab (8.35–13.84)7.79 ± 0.12bcdef (6.45–9.4)19.55 ± 0.33a (16.67–23.75)4.63 ± 0.08c (3.85–5.44)Curved fusoid
GX116.52 ± 0.38d (13.64–23.14)6.9 ± 0.19bcd (5.1–9.79)10.75 ± 0.25ab (8.67–14.15)7.88 ± 0.13bcdef (6.53–9.56)19.3 ± 0.38ab (15.41–25.35)4.68 ± 0.11c (3.59–5.81)Curved fusoid
HC217.11 ± 0.42cd (12.39–22.34)7.35 ± 0.16b (5.63–9.59)10.87 ± 0.23ab (9.02–13.49)7.83 ± 0.13bcdef (6.56–9.25)18.82 ± 0.36ab (13.23–21.34)4.72 ± 0.12c (3.4–5.84)Curved fusoid
LC717.07 ± 0.24cd (14.44–19.92)7.03 ± 0.17bcd (5.47–8.77)10.97 ± 0.2ab (9.24–12.94)7.69 ± 0.14def (6.55–8.97)19.2 ± 0.34ab (14.32–24.04)4.67 ± 0.11c (3.79–6.13)Curved fusoid
NC2516.38 ± 0.4d (12.89–22.79)6.72 ± 0.18d (4.89–8.66)11.17 ± 0.19ab (9.33–12.91)7.77 ± 0.14cdef (6.54–9.26)19.05 ± 0.37ab (16.53–23.89)4.55 ± 0.09c (3.2–5.65)Curved fusoid
SC616.68 ± 0.29cd (13.49–20.71)6.58 ± 0.16d (4.5–8.25)10.42 ± 0.23b (8.49–12.86)7.86 ± 0.11bcdef (6.61–8.95)19.06 ± 0.39ab (13.64–24.69)4.68 ± 0.12c (3.1–6.19)Curved fusoid
YH616.61 ± 0.38cd (14.36–22.58)6.68 ± 0.17d (4.95–8.83)10.68 ± 0.25ab (8.04–12.95)7.99 ± 0.14abcde (6.76–9.97)18.8 ± 0.31ab (15.41–21.99)4.72 ± 0.12c (3.7–6.13)Curved fusoid
C. gloeosporioides
BM617.07 ± 0.28cd (14.72–19.84)6.76 ± 0.16cd (5.15–8.45)11.05 ± 0.2ab (9.55–13.48)8.27 ± 0.15ab (6.94–10.39)13.24 ± 0.3d (10.66–16.8)4.83 ± 0.09c (3.91–5.98)Cylindrical
GX317.25 ± 0.37cd (13.44–23.81)6.93 ± 0.12bcd (5.87–8.1)11.12 ± 0.18ab (9.13–13.01)8.1 ± 0.16abcd (6.06–10.61)13.14 ± 0.32d (9.86–17.07)4.81 ± 0.09c (3.62–5.84)Cylindrical
LC216.96 ± 0.26cd (15.06–21.22)7.04 ± 0.16bcd (4.95–9.69)11.18 ± 0.18ab (9.48–13.12)8.24 ± 0.14abc (6.94–10.11)12.9 ± 0.33d (9.02–16.54)4.89 ± 0.09c (3.79–5.84)Cylindrical
YM417.76 ± 0.33bc (15.69–24.82)7.26 ± 0.13bc (5.96–8.67)11.1 ± 0.21ab (9.63–13.91)8.38 ± 0.12a (6.99–10.16)13.23 ± 0.29d (10.73–16.06)4.85 ± 0.08c (4.19–5.98)Cylindrical

Morphological characteristics of Colletotrichum isolates from Cyclocarya paliurus.

Data are mean ± standard error, with ranges in parentheses. Columns with the same letter do not differ significantly according to Duncan’s test (P < 0.05).

The phylogenetic analysis for each individual locus and the concatenated matrix were inferred under the Bayesian inference (BI) and maximum-likelihood (ML) criteria in MrBayes 3.2.6 (Ronquist et al., 2012) and MEGA 7 (Kumar et al., 2016), respectively. For BI analysis, the best nucleotide substitution model of each locus was ascertained by MrModeltest 2.3 according to AICc, with K2 + I identified for CHS, TN93 identified for GADPH, K2 + G identified for ACT and ApMat, GTR + G identified for CAL and GS, and TN93 + G identified for ITS and TUB. Four Markov chains were run for 30 million generations simultaneously, with trees sampled every 1000 generations. The first 25% of trees were discarded as the burn-in phase of the analyses, while the remaining trees were used for calculating posterior probabilities (PPs) in the majority rule consensus tree. ML analysis was performed based on the GTR + G + I model, and clade support was determined by 1000 bootstrap replicates, with gaps treated as missing data.

Morphological and Biological Characterization

Fourteen representative isolates were selected for further studies according to BI/ML phylogenetic analysis (Table 1). Mycelial blocks (2 mm in side length) aseptically taken from actively growing cultures were transferred to new PDA plates and incubated at 25°C in darkness. Colony characteristics, including conidiomata or ascomata production, were determined up to 30 days post-inoculation (dpi). Conidia, appressoria, ascospores, and asci for microscopy were obtained and examined according to the procedure described by Weir et al. (2012). At least 30 measurements per structure were recorded at ×100 magnification using a ZEISS Axio Imager A2m microscope (Carl Zeiss, Göttingen, Germany) equipped with differential interference contrast (DIC) optics. To observe fungal structures developed on infected tissue, leaves showing typical symptoms of anthracnose were collected and prepared using the method of Huang et al. (2018), with photomicrographs taken by a Regulus 8100 field emission scanning electron microscope (FE-SEM, Japan).

To determine the optimal temperature for colony growth, mycelial blocks (2 mm in side length) of 14 representative isolates were cultured as described above and incubated at temperatures of 5–40°C with 5°C intervals. The colony diameter was measured at two perpendicular angles, and the average was taken at 4 dpi. Five replicates per isolate were examined at all eight temperatures, and the experiment was conducted twice. Differences in the morphological and biological characteristics of the isolates were determined by one-way analysis of variance (ANOVA) using IBM SPSS Statistics 24.0 software (SPSS, Inc., Chicago, IL, United States).

Virulence Tests of Colletotrichum Isolates

Virulence tests were conducted with reference to previous reports with minor modifications (Huang et al., 2016; Chen Y. et al., 2017; Xue et al., 2019). Fourteen representative Colletotrichum isolates were selected and cultured on PDA and used for virulence tests on detached C. paliurus leaves under controlled conditions (Table 2). Conidial suspensions of each isolate were prepared as previously described and adjusted to two concentrations of 1 × 106 and 1 × 108 conidia/mL with ddH2O.

Asymptomatic C. paliurus leaves were surface disinfected and air-dried as mentioned above, and then one piercing wound was made on the right side of each leaf using a sterile needle (insect pin, 0.71 mm in diameter), or the leaves were left unwounded. Wound inoculation was performed by placing an 8 μL conidial suspension (1 × 106 conidia/mL) or mycelial blocks (5 mm in length) from margins of actively growing colonies onto each stab wound. Non-wound inoculation was conducted by placing an 8 μL spore suspension (1 × 108 conidia/mL) or mycelial blocks onto the mid-right region of the leaves without pin pricking. Leaves inoculated with ddH2O or non-colonized PDA blocks were treated as negative controls. The experiment was conducted in triplicate for each treatment and control, involving five leaves per replicate. All treatments and controls were placed into transparent containers (334 × 215 × 87 mm) lined with moist sterile filter paper and sealed by plastic wrap to maintain a high relative humidity and then incubated at 25°C under a 12 h photoperiod in a growth chamber. The whole experiment was carried out twice.

Disease incidence was determined at 10 dpi, while the incubated leaves were monitored for the onset of anthracnose lesions for up to 20 dpi. Virulence was determined by measuring the diameter of the necrotic lesions in two perpendicular directions at 7 and 10 dpi for the wounded and non-wounded leaves, respectively. Differences in the virulence of the isolates were determined by ANOVA, and mean values were compared by Tukey’s test (P < 0.05) using SPSS as previously described. Each Colletotrichum isolate involved in the virulence test was reisolated from the inoculated leaves, and their identity was confirmed by morphological and molecular approaches as previously described to fulfill Koch’s postulates.

Biofungicide Sensitivity Assessments in vitro

Effects on Mycelial Growth

Phenazine-1-carboxylic acid [1% active ingredient (a.i.); Shanghai Non-gle Biological Products Co., Ltd., Shanghai, China], tetramycin (0.3% a.i.; Liaoning Wkioc Bioengineering Co., Ltd., Liaoning, China), and kasugamycin (4% a.i.; Shaanxi Microbe Biotechnology Co., Ltd., Shaanxi, China) were used. Fourteen representative isolates were selected based on the above studies. The fungicide sensitivity of each isolate was tested on complete medium (CM) plates (Yeast extract 10 g/L, Casamino-acid 5 g/L, Agar 15 g/L, 1% sterile glucose after autoclaving) amended with fungicides. Mycelial blocks (2 mm in side length) aseptically taken from actively growing cultures were placed onto CM with or without (control) fungicide amendments. The final concentrations of each a.i. in the amended media were 0.1, 0.25, 0.5, 1, 2.5, and 5 μg/mL for tetramycin and 1, 2.5, 5, 10, 25, and 50 μg/mL for PCA and kasugamycin. Each treatment was tested in triplicate, and the entire experiment was repeated twice. The mean colony diameter was measured at 4 dpi, and the formula for percent inhibition was [(radial growth of the control – radial growth at fungicide concentration)/radial growth of the control] × 100%. Half of the maximal effective concentration (EC50) was estimated by regression to the log10 probability conversion of the percentage of inhibition of the fungicide concentrations.

Effects on Spore Germination

Tetramycin was selected to test its ability to inhibit conidia germination. Spore suspensions and fungicide solutions were mixed with sterilized water to 10 mL volume. The final fungicide concentrations were 0.005, 0.01, 0.05, 0.1, 0.5, and 1 μg/mL, while spore suspension was adjusted to 1 × 105 spores/mL for each treatment. A 20 μL droplet of each suspension was placed on a hydrophobic cover slip and incubated at 25°C for 18–20 h in a humidity chamber according to Fang et al. (2018). Each treatment was conducted in triplicate, and the entire experiment was repeated twice. Conidia were then observed at ×100 magnification using a ZEISS microscope and scored as germinated if the length of the germ tube was longer than half of the conidial length. The conidial germination inhibition rate was calculated as previously described (Munir et al., 2016).

Results

Field Symptoms and Colletotrichum Isolates

In May 2018, typical symptoms of anthracnose were first observed on newly emerged leaves of C. paliurus in a commercial nursery in Baima (Figure 1A), and the infection quickly spread to all C. paliurus nurseries within the growing season, with the infection rate reaching 64% (150 trees were investigated). Similar symptoms were observed in plant bases at Changzhou and Yancheng, with infection rates over 35 and 45% (100 trees were investigated), respectively. The initial symptoms appeared in the form of subcircular or irregular pale-brown spots scattered on the leaves (Figure 1C). Gradually, the lesions enlarged and coalesced to form large necrotic areas, which turned off-white surrounded by a dark-brown border as symptoms progressed (Figure 1B). The dead tissue withered, resulting in premature defoliation of the plant in severe cases (Figure 1A). Under high-moisture conditions, a number of acervuli were formed in concentric rings and oozed gelatinous orange spore masses (Figure 1D). Photomicrographs further corroborated the presence of conidiophores and conidia on the surfaces of leaf lesions under optical or SEM microscopy (Figures 1E,F).

A total of 44 monosporic Colletotrichum isolates were recovered from symptomatic tissues and used for further molecular identification (Table 1). The shapes and sizes of conidia of these cultures were basically concordant with the sporulation on the lesions (Figures 2C, 3C, 4C). The general morphological characteristics of all isolates resembled those of Colletotrichum species.

FIGURE 2

FIGURE 3

FIGURE 4

Molecular Identification and Phylogenetic Analysis

In the present study, the ITS, CAL, ACT, GPDH, TUB, CHS-1, GS, and ApMat region/genes of all 44 monosporic isolates were successfully amplified and sequenced (Table 1). Sequences generated herein along with reference sequences from ex-type or other authoritative specimens were concatenated for phylogeny construction, composing a dataset of 3192 characters, with 1828 constant characters, 574 parsimony-uninformative characters, and 790 parsimony-informative characters.

The topological structure of the phylogenetic trees constructed using BI and ML criteria was basically consistent, demonstrating that the evolutionary relationships of the experimental strains were statistically supported. A consensus tree with clade support from bootstrap proportions (BPs) and PP values was generated (Figure 5). The phylogenetic tree revealed that all 44 Colletotrichum isolates belonged to three well-separated clades and nested within the C. gloeosporioides species complex. Six Colletotrichum isolates composed a highly supported clade (100% BP/1.00 PP) with the Colletotrichum aenigma type strain ICMP 18608. Twenty-eight isolates belonged to the other highly supported clade (100% BP/1.00 PP) along with the Colletotrichum fructicola type strain ICMP 18581. Ten isolates clustered in another highly supported clade (100% BP/1.00 PP) with the C. gloeosporioides s. s. type strain IMI 356878 (Figure 5).

FIGURE 5

Morphological and Biological Analyses

Fourteen representative isolates clustered in three clades in the ML/BI phylogenetic analysis, including three of C. aenigma, seven of C. fructicola, and four of C. gloeosporioides s. s., were selected for further studies (Table 1).

Colonies of C. fructicola isolates produced abundant grayish-green aerial hyphae with white halo edges, and the back of the colony was grayish-green with concentric rings (Figures 3A,B). Isolates of C. aenigma and C. gloeosporioides s. s. exhibited white or gray mycelia, and the back of the colony was densely arranged with a grayish-green color in the center (Figures 2A,B, 4A,B). There were few differences in the shapes of conidia, conidiophores, and appressoria among the three species. Conidia were all one-celled, hyaline, smooth-walled, mostly cylindrical with broadly rounded ends, and sometimes slightly and gradually acute to the end (Figures 2C, 3C, 4C). The average conidial sizes for isolates were as follows: C. aenigma, 14.3–26.6 × 5.56–11.13 μm; C. fructicola, 12–23.14 × 4.5–9.79 μm; and C. gloeosporioides s. s., 13.44–24.82 × 4.95–9.69 μm (Table 3). Conidiophores were smooth-walled, septate, and hyaline to pale brown (Figures 2E, 3F, 4E). Appressoria were dark brown, subglobose or ellipsoid, and rarely irregular (Figures 2D, 3D, 4D). The average appressorium sizes for the isolates were as follows: C. aenigma, 8.35–16.92 × 5.87–11.73 μm; C. fructicola, 8.04–14.15 × 6.45–9.97 μm; and C. gloeosporioides s. s., 9.13–13.91 × 6.06–10.61 μm (Table 3). Ascomata of three Colletotrichum species formed on PDA at 20 dpi and were semi-immersed in agar medium, dark-brown, and subglobose to pyriform (Figures 2F, 3E, 4F). Asci were clavate, fasciculate, and eight-spored in most cases, while asci of C. gloeosporioides s. s. were not observed (Figures 2G, 3G). Ascospores of C. aenigma isolates were hyaline, smooth-walled, aseptate, cylindrical, and 15.94–22.36 × 5.56–9.17 μm in size (Table 3 and Figure 2H). Ascospores of C. gloeosporioides s. s. isolates were hyaline, smooth-walled, aseptate, cylindrical, and 9.02–17.07 × 3.62–5.98 μm in size (Table 3 and Figure 4G). Ascospores of C. fructicola were hyaline, aseptate, smooth-walled, fusoid, slightly curved, straight with round ends, and 13.23–25.35 × 3.1–6.19 μm in size (Table 3 and Figure 3H).

All 14 representative isolates tested exhibited a similar growth pattern on PDA at the different treatment temperatures. No mycelial growth of any tested isolates was observed in vitro at 5°C. The optimum mycelial growth temperature of the three Colletotrichum species was 25–30°C, but the high temperature tolerance of the three species was different. Isolates of C. aenigma and C. fructicola were more sensitive to high temperature and grew very slowly (or could not grow) at 40°C, with mean growth rates lower than those of C. gloeosporioides s. s. isolates.

Virulence Tests of Colletotrichum Isolates

All 14 selected isolates were pathogenic on leaves of C. paliurus and reproduced typical symptoms of anthracnose. Seven days after wounded or non-wounded inoculation, distinct brown or off-white necrotic lesions with dark-brown boundaries developed (Figure 6), while no symptoms developed on the corresponding mock controls.

FIGURE 6

The severity of disease caused by these isolates showed significant differences (Table 4). Isolates of C. gloeosporioides s. s. generally showed strong virulence, with mean lesion diameters ranging from 17.88 to 23.16 and 17.52 to 22.11 mm with wounded and non-wounded inoculation using mycelial plugs as inocula, respectively. There was no significant difference in virulence among C. fructicola isolates in C. paliurus leaves, with mean lesion diameters ranging from 16.65 to 20.52 and 17.41 to 21.09 mm with wounded and non-wounded inoculation using mycelial plugs as inocula, respectively. C. aenigma isolates showed much weaker virulence, with mean lesion diameters ranging from 12.38 to 14.89 and 11.78 to 14.12 mm with wounded and non-wounded inoculation using mycelial plugs as inocula, respectively. The lesions produced by mycelial inoculation were generally larger than those produced by spore suspension inoculation among the three Colletotrichum species (Table 4). Colletotrichum gloeosporioides s. s. isolate BM6 and C. fructicola isolate BM5 produced reproductive structures of the fungus on the necrotic lesions (Figure 6). C. fructicola isolate YH6 produced lesions with a wheel-shaped pattern on C. paliurus leaves (Figure 6). The Colletotrichum species were reisolated from all inoculated symptomatic leaves and were found to be morphologically and molecularly identical to the original isolates using the aforementioned methods, thus fulfilling Koch’s postulates.

TABLE 4

Species/IsolatesInfected leaves (%)a
Lesion diameter (mm)b
Conidial suspension
Mycelial plug
Conidial suspension
Mycelial plug
WoundedNon-woundedWoundedNon-woundedWoundedNon-woundedWoundedNon-wounded
CK
C. aenigma
HC380.00 ± 11.5560.00 ± 0.00100.00 ± 0.0086.67 ± 6.679.63 ± 0.9b5.79 ± 0.56b12.38 ± 1.10f14.12 ± 1.28cd
SC793.33 ± 6.6760.00 ± 0.00100.00 ± 0.0093.33 ± 6.679.58 ± 0.96b5.77 ± 0.48b13.10 ± 0.82ef14.44 ± 0.92cd
YM873.33 ± 6.6766.67 ± 6.67100.00 ± 0.0086.67 ± 6.678.9 ± 0.81b5.41 ± 0.39b14.89 ± 1.07def11.78 ± 1.02d
C. fructicola
BM593.33 ± 6.6780.00 ± 11.55100.00 ± 0.00100.00 ± 0.0017.69 ± 0.99a15.85 ± 1.26a20.52 ± 0.61abc20.37 ± 0.91ab
GX193.33 ± 6.6773.33 ± 6.67100.00 ± 0.0093.33 ± 6.6716.44 ± 1.07a13.85 ± 1.26a18.75 ± 0.76bcd20.16 ± 0.98ab
HC286.67 ± 6.6780.00 ± 11.55100.00 ± 0.00100.00 ± 0.0016.41 ± 1.16a13.86 ± 1.27a18.18 ± 1.06bcd19.75 ± 1.03abc
LC786.67 ± 6.6786.67 ± 6.67100.00 ± 0.0093.33 ± 6.6716.21 ± 1.03a14.73 ± 1.49a20.51 ± 0.94abc18.59 ± 1.76abc
NC2593.33 ± 6.6786.67 ± 13.33100.00 ± 0.0093.33 ± 6.6716.34 ± 0.88a13.41 ± 1.03a18.93 ± 1.07bcd21.09 ± 0.95a
SC693.33 ± 6.6773.33 ± 6.67100.00 ± 0.0093.33 ± 6.6715.45 ± 1.16a12.93 ± 1.52a16.90 ± 0.94cde18.06 ± 1.54abc
YH693.33 ± 6.6780.00 ± 11.55100.00 ± 0.00100.00 ± 0.0015.56 ± 1.04a13.87 ± 1.12a16.65 ± 0.87cde17.41 ± 1.14abc
C. gloeosporioides
BM686.67 ± 6.6780.00 ± 11.55100.00 ± 0.00100.00 ± 0.0018.43 ± 0.93a15.92 ± 1.14a23.16 ± 0.80a22.11 ± 0.66a
GX386.67 ± 6.6786.67 ± 6.67100.00 ± 0.00100.00 ± 0.0017.24 ± 0.91a16.35 ± 0.87a20.29 ± 0.81abc19.03 ± 1.03abc
LC286.67 ± 6.6780.00 ± 11.55100.00 ± 0.00100.00 ± 0.0017.27 ± 0.97a12.98 ± 0.86a17.88 ± 0.61bcd17.52 ± 1.68abc
YM493.33 ± 6.6780.00 ± 11.55100.00 ± 0.00100.00 ± 0.0017.44 ± 0.63a15.21 ± 1.49a20.40 ± 0.58abc21.39 ± 1.03a

Pathogenicity of Colletotrichum isolates on detached leaves of Cyclocarya paliurus.

a,bValues were means ± standard error of three replications. Means with different letters indicate mean lesion lengths that are significantly different (P < 0.05). Data were calculated using disease incidence of 15 inoculated leaves. – represents no symptom developed on inoculated site. CKDetached C. paliurus leaves were inoculated with sterile water or PDA plugs without the pathogens (as controls).

Sensitivity of Colletotrichum Isolates to Biofungicides

Fourteen representative isolates evaluated showed similar biological responses to all tested biofungicides. Kasugamycin at 50 mg/mL showed no suppressive activity against the mycelial growth of the three Colletotrichum spp. on CM medium (EC50 > 100 μg/mL). PCA showed moderate inhibition of the mycelial growth of the three Colletotrichum spp., with isolates of C. fructicola exhibiting more sensitivity to this biofungicide. The EC50 of tetramycin against the mycelial growth of all representative isolates was lower than that of any of the other biofungicides, including the low EC50 of tetramycin against spore germination, indicating that tetramycin was the most effective biofungicide against the three Colletotrichum spp. used in this study.

Discussion

In recent years, the cultivation of C. paliurus has undergone a major expansion to meet the increasing demand for young leaves of this species for medical use or C. paliurus tea production in China, which may have caused the high incidence of foliar diseases in these newly established plantations. Therefore, it is of great importance to diagnose and control these fungal diseases of C. paliurus. Unfortunately, little information was available about these diseases, i.e., C. paliurus anthracnose. Hitherto, this study is first comprehensive analysis demonstrating the etiology of C. paliurus anthracnose in China, providing valuable information about the phenotypic and molecular characteristics, virulence, and fungicide sensitivity of the causal agents associated with this disease. Moreover, this study provides the first report of C. aenigma, C. fructicola, and C. gloeosporioides s. s. causing C. paliurus anthracnose in China as well as in the world.

Colletotrichum gloeosporioides species complex is regarded as the most challenging taxa within the Colletotrichum genus (Silva et al., 2012). Although polyphasic method is recommended for characterizing Colletotrichum species, there is still lack of consensus among taxonomists on the selection of markers for phylogenetic studies (Cao et al., 2020; Vieira et al., 2020). Recent studies revealed that concatenated GS and ApMat alignment can achieve a satisfactory Colletotrichum species identification (Liu et al., 2015; Sharma et al., 2017). Conservative region/genes (ITS, GAPDH, CAL, CHS-1, ACT, and TUB) have been previously accepted for delimiting species in this species complex (Weir et al., 2012). Therefore, in the present study, eight loci (ITS, GAPDH, CAL, CHS-1, ACT, TUB, including GS and ApMat) were selected in phylogenetic analysis for Colletotrichum isolates classification. Based on BI/ML multilocus concatenated phylogenetic analyses, including sequences from 28 authentic specimens in the C. gloeosporioides species complex, the 44 isolates were categorized into three well-separated clades: six isolates clustered in the C. aenigma clade (14%), 28 isolates clustered in the C. fructicola clade (64%), and 10 isolates clustered in the C. gloeosporioides s. s. clade (22%). With respect to phenotypic characterization based on colony morphology, characteristics of conidia, appressoria, ascospores, and asci were entirely in line with the results of the molecular data.

Colletotrichum fructicola was first described by Prihastuti et al. (2009), causing coffee berry disease in Thailand. The species is geographically diverse and threatens a wide range of hosts, which has been reported on Fragaria × ananassa and Malus sp. (United States), Ficus sp. (Germany), Persea americana (Australia), Pyrus pyrifolia (Japan), Limonium sp. (Israel), Tetragastris sp. and Theobroma sp. (Panama), Dioscorea sp. (Nigeria), Malus sp. (Brazil) (Weir et al., 2012), and Mangifera indica (China) (Mo et al., 2018). In the current study, C. fructicola was the most predominant species and exhibited strong pathogenicity (Table 4), which seems to be the most economically harmful species of C. paliurus anthracnose in Jiangsu Province, China.

Colletotrichum gloeosporioides s. s., a genetically and biologically diverse species, previously reported to infect fruits in tropical area (Sangeetha and Rawal, 2008; Udayanga et al., 2013), which is probably related to its ability to tolerate high temperatures (Table 5). However, this species was recently reported increasingly prevalent in the temperate region, such as Hebei, Shandong, and Shanxi Provinces of China (Jayawardena et al., 2016; Wang et al., 2020). Results in the present study demonstrated that C. gloeosporioides showed the strongest pathogenicity to C. paliurus (Table 4). The prevalence and ecological adaptation zone of C. gloeosporioides on C. paliurus in China would be further studied.

TABLE 5

Species/Isolates5°C10°C15°C20°C25°C30°C35°C40°C
C. aenigma
HC30a2.01 ± 0.1ab3.92 ± 0.09abc7.67 ± 0.01abc12.43 ± 0.14b12.39 ± 0.14a7.6 ± 0.57a2.4 ± 1.22ab
SC70a2.26 ± 0.2a3.77 ± 0.12abc7.66 ± 0.04abc12.66 ± 0.19b12.62 ± 0.09a7.69 ± 0.08a2.13 ± 1.11ab
YM80a2.24 ± 0.17a3.79 ± 0.15abc7.96 ± 0.05abc12.28 ± 0.31b12.19 ± 0.08a7.72 ± 0.56a0b
C. fructicola
BM50a1.11 ± 0.56ab3.54 ± 0.22abc8.81 ± 0.09ab15.49 ± 0.04a12.93 ± 0.28a5.64 ± 0.48b2.71 ± 1.36ab
GX10a1.79 ± 0.12ab3.61 ± 0.09abc8.32 ± 0.28abc15.81 ± 0.04a13.56 ± 0.25a5.17 ± 0.42b2.71 ± 1.35ab
HC20a1.62 ± 0.18ab3.2 ± 0.19abc8.46 ± 0.49abc15.42 ± 0.12a13.33 ± 0.27a4.91 ± 0.08b0b
LC70a1.36 ± 0.14ab3.72 ± 0.16abc8.96 ± 0.07a15.84 ± 0.07a12.99 ± 0.45a5.59 ± 0.11b1.99 ± 0.05ab
NC250a0.91 ± 0.46b3.35 ± 0.19abc8.56 ± 0.35abc15.68 ± 0.13a12.93 ± 0.34a5.36 ± 0.46b2.66 ± 1.33ab
SC60a1.68 ± 0.28ab3.27 ± 0.35bc8.12 ± 0.17abc15.74 ± 0.17a13.45 ± 0.45a5.44 ± 0.34b0b
YH60a1.61 ± 0.21ab3.64 ± 0.24abc8.28 ± 0.35abc15.9 ± 0.15a13.42 ± 0.14a5.7 ± 0.47b2.08 ± 0.13ab
C. gloeosporioides
BM60a1.84 ± 0.07ab4.27 ± 0.13a7.37 ± 0.38c11.54 ± 0.36bc12.37 ± 0.65a8.12 ± 0.21a3.36 ± 0.99ab
GX30a1.89 ± 0.17ab4.21 ± 0.2ab7.62 ± 0.13bc11.62 ± 0.46bc12.66 ± 0.17a8.35 ± 0.2a5.25 ± 1.13a
LC20a1.76 ± 0.19ab4.24 ± 0.13a7.57 ± 0.29bc10.88 ± 0.26c11.75 ± 0.18a8.1 ± 0.12a3.2 ± 0.76ab
YM40a1.93 ± 0.19ab4.26 ± 0.17a7.73 ± 0.38abc12.04 ± 0.43bc12.42 ± 0.8a8.01 ± 0.15a2.43 ± 0.74ab

Growth rate (mm/4d) of Colletotrichum isolates from Cyclocarya paliurus cultured on PDA at different temperatures.

Columns with the same letter do not differ significantly according to Tukey’s test (P < 0.05).

Interestingly, multiple Colletotrichum species were isolated and identified from the same leaf and even within the same lesion of single C. paliurus trees. As reported in previous studies, several Colletotrichum species can cause anthracnose on the same host (Munir et al., 2016; Chen Y. et al., 2017; De Silva et al., 2017a; Diao et al., 2017; Guarnaccia et al., 2017; Fu et al., 2019; Xue et al., 2019). It is reasonable to believe that C. paliurus anthracnose may be a complex disease. With more samples collected, it is possible that even more Colletotrichum species, or even novel species, will be characterized as responsible for this disease. Consequently, future attention should be given to probe Colletotrichum species collected from C. paliurus anthracnose in different geographical areas with different latitudes or elevations in China.

Temperature is an indispensable factor that affects epidemics of anthracnose or other plant diseases (Dubrulle et al., 2020). High temperatures and their frequency may be the factors leading to the delay or non-occurrence of plant diseases (Han et al., 2016; Xue et al., 2019). In the present study, no significant differences occurred in the optimum and minimum mycelial growth temperatures of C. aenigma and C. fructicola, while C. gloeosporioides s. s. isolates exhibited more tolerance to high temperature, which was in concordance with previous study results (Han et al., 2016). These data may provide useful information for C. paliurus anthracnose control strategies: fungicide applications should be timed before the optimum growth temperature is reached.

Once infection occurs, the suppression of spore germination and mycelial growth within the plant tissue plays a crucial role in anthracnose management. In the present study, tetramycin showed excellent inhibitory effect on the mycelial growth and spore germination of the three Colletotrichum species (Table 6). The satisfactory inhibitory activity against different life stages of Colletotrichum species indicates that tetramycin may be a potential alternative for the management of C. paliurus anthracnose. In previous studies, the excellent curative and protective activity of tetramycin has been widely reported in Phytophthora blight, rice blast, tomato leaf mold, Corynespora leaf spot, and cucumber gray mold (Zhao et al., 2010; Miao et al., 2015; Song et al., 2016; Chen L. L. et al., 2017; Ma et al., 2018a, b), demonstrating that tetramycin would be helpful to prevent the occurrence and spread of plant diseases throughout the field. Accordingly, protective and curative activity of tetramycin on C. paliurus anthracnose in the field trials would be further studied before it is put into use.

TABLE 6

Species/IsolateEC50 (mg/liter)z
Mycelial growth
Spore germination
TetramycinPCAKasugamycinTetramycin
C. aenigma
HC32.5 ± 0.0122.95 ± 6.39>1000.02 ± 0.00
SC72.59 ± 0.1142.05 ± 12.64>1000.15 ± 0.01
YM82.51 ± 0.0139.5 ± 14.03>1000.02 ± 0.01
C. fructicola
BM52.61 ± 0.1219.54 ± 2.18>1000.02 ± 0.01
GX12.41 ± 0.0824.67 ± 4.42>1000.02 ± 0.01
HC22.65 ± 0.2224.67 ± 5.3>1000.02 ± 0.01
LC72.46 ± 0.1132.24 ± 5.03>1000.03 ± 0.02
NC252.44 ± 0.0120.14 ± 0.93>1000.01 ± 0.00
SC62.45 ± 0.1326.16 ± 4.85>1000.02 ± 0.00
YH62.59 ± 0.0715.61 ± 1.49>1000.02 ± 0.00
C. gloeosporioides
BM63.15 ± 0.4640.71 ± 9.07>1000.04 ± 0.01
GX32.6 ± 0.1940.47 ± 9.56>1000.02 ± 0.00
LC23.1 ± 0.4640.21 ± 7.54>1000.02 ± 0.00
YM43.03 ± 0.3538.03 ± 9.7>1000.01 ± 0.00

Mean half-maximal effective concentration (EC50) of Colletotrichum spp.

zData are mean ± standard error.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.

Author contributions

X-RZ was responsible for the entire process of experimentation and writing the manuscript. M-JZ helped perform the experiment and analyze the results. X-LS and S-ZF provided experimental materials. F-MC supervised the work. All authors contributed to manuscript revision and read and approved the submitted version.

Funding

This study was financially supported by the Postgraduate Research and Practice Innovation Program of Jiangsu Province (KYCX20_0875).

Acknowledgments

The authors would like to thank the reviewers for their valuable suggestions on this manuscript.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2020.613499/full#supplementary-material

References

  • 1

    AlijaniZ.AminiJ.AshengrophM.BahramnejadB. (2019). Antifungal activity of volatile compounds produced by Staphylococcus sciuri strain MarR44 and its potential for the biocontrol of Colletotrichum nymphaeae, causal agent strawberry anthracnose.Int. J. Food Microbiol.307:10827. 10.1016/j.ijfoodmicro.2019.108276

  • 2

    Bautista-CruzM. A.Almaguer-VargasG.Leyva-MirS. G.Colinas-LeonM. T.CorreiaK. C.Camacho-TapiaM.et al (2019). Phylogeny, Distribution, and Pathogenicity of Lasiodiplodia Species Associated With Cankers and Dieback Symptoms of Persian Lime in Mexico.Plant Dis.10311561165. 10.1094/PDIS-06-18-1036-RE

  • 3

    BiY.CuiX.LuX.CaiM.LiuX.HaoJ. J. (2011). Baseline Sensitivity of Natural Population and Resistance of Mutants in Phytophthora capsici to Zoxamide.Phytopathology10111041111. 10.1094/PHYTO-01-11-0010

  • 4

    CaiL.HydeK. D.TaylorP. W. J.WeirB. S.WallerJ. M.AbangM. M.et al (2009). A polyphasic approach for studying Colletotrichum.Fungal Div.39183204.

  • 5

    CannonP. F.DammU.JohnstonP. R.WeirB. S. (2012). Colletotrichum - current status and future directions.Stud. Mycol.73181213. 10.3114/sim0014

  • 6

    CaoX. R.XuX. M.CheH. Y.WestJ. S.LuoD. Q. (2020). Eight Colletotrichum species, including a novel species, are associated with areca palm anthracnose in Hainan.China. Plant Dis.10413691377. 10.1094/PDIS-10-19-2077-RE

  • 7

    CaoY.FangS.YinZ.FuX.ShangX.YangW.et al (2017). Chemical Fingerprint and Multicomponent Quantitative Analysis for the Quality Evaluation of Cyclocarya paliurus Leaves by HPLC-Q-TOF-MS.Molecules22:1927. 10.3390/molecules22111927

  • 8

    CarboneI.KohnL. M. (1999). A method for designing primer sets for speciation studies in filamentous ascomycetes.Mycologia91553556. 10.2307/3761358

  • 9

    ChenL. L.GuoB. B.LiB. X. (2017). Toxicity and control efficacy of tetramycin against Passalora fulva.Chin. J. Pestic. Sci.19324330.

  • 10

    ChenY.QiaoW.ZengL.ShenD.LiuZ.WangX.et al (2017). Characterization, Pathogenicity, and Phylogenetic Analyses of Colletotrichum Species Associated with Brown Blight Disease on Camellia sinensis in China.Plant Dis.10110221028. 10.1094/PDIS-12-16-1824-RE

  • 11

    DammU.CannonP. F.WoudenbergJ. H. C.CrousP. W. (2012). The Colletotrichum acutatum species complex.Stud. Mycol7337113. 10.3114/sim0010

  • 12

    DammU.SatoT.AlizadehA.GroenewaldJ. Z.CrousP. W. (2019). The Colletotrichum dracaenophilum, C. magnum and C. orchidearum species complexes.Stud. Mycol.92146. 10.1016/j.simyco.2018.04.001

  • 13

    De SilvaD. D.AdesP. K.CrousP. W.TaylorP. W. J. (2017a). Colletotrichum species associated with chili anthracnose in Australia.Plant Pathol.66254267. 10.1111/ppa.12572

  • 14

    De SilvaD. D.CrousP. W.AdesP. K.HydeK. D.TaylorP. W. J. (2017b). Life styles of Colletotrichum species and implications for plant biosecurity.Fungal Biol. Rev.31155168. 10.1016/j.fbr.2017.05.001

  • 15

    DeanR.Van KanJ. A. L.PretoriusZ. A.Hammond-KosackK. E.Di PietroA.SpanuP. D.et al (2012). The Top 10 fungal pathogens in molecular plant pathology.Mol. Plant Pathol.13804804. 10.1111/j.1364-3703.2012.00822.x

  • 16

    DengB.CaoY.FangS.ShangX.YangW.QianC. (2015). Variation and stability of growth and leaf flavonoid content in Cyclocarya paliurus across environments.Ind. Crop. Prod.76386393. 10.1016/j.indcrop.2015.07.011

  • 17

    DiaoY. Z.ZhangC.LiuF.WangW. Z.LiuL.CaiL.et al (2017). Colletotrichum species causing anthracnose disease of chili in China.Persoonia382037. 10.3767/003158517X692788

  • 18

    DuanY.XiaoX.LiT.ChenW.WangJ.FraaijeB. A.et al (2018). Impact of epoxiconazole on Fusarium head blight control, grain yield and deoxynivalenol accumulation in wheat.Pestic. Biochem. Phys.152138147. 10.1016/j.pestbp.2018.09.012

  • 19

    DubrulleG.PensecF.PicotA.RigalmaK.PawtowskiA.NicolleauS.et al (2020). Phylogenetic Diversity and Effect of Temperature on Pathogenicity of Colletotrichum lupini.Plant Dis.104938950. 10.1094/PDIS-02-19-0273-RE

  • 20

    FangS.YangW.ChuX.ShangX.SheC.FuX. (2011). Provenance and temporal variations in selected flavonoids in leaves of Cyclocarya paliurus.Food Chem.12413821386. 10.1016/j.foodchem.2010.07.095

  • 21

    FangY.XiaL.WangP.ZhuL.YeJ.HuangL. (2018). The MAPKKK CgMck1 Is Required for Cell Wall Integrity, Appressorium Development, and Pathogenicity in Colletotrichum gloeosporioides.GENES9:543. 10.3390/genes9110543

  • 22

    FreemanS.KatanT.ShabiE. (1998). Characterization of Colletotrichum Species Responsible for Anthracnose Diseases of Various Fruits.Plant Dis.82596605. 10.1094/PDIS.1998.82.6.596

  • 23

    FuM.CrousP. W.BaiQ.ZhangP. F.XiangJ.GuoY. S.et al (2019). Colletotrichum species associated with anthracnose of Pyrus spp. in China.Persoonia42135. 10.3767/persoonia.2019.42.01

  • 24

    GaoY. Y.LiX. X.HeL. F.LiB. X.MuW.LiuF. (2020). Effect of Pyrisoxazole on Colletotrichum scovillei Infection and Anthracnose on Chili.Plant Dis.104551559. 10.1094/PDIS-06-19-1291-RE

  • 25

    GardesM.BrunsT. D. (1993). ITS primers with enhanced specificity for basidiomycetes–application to the identification of mycorrhizae and rusts.Mol. Ecol.2113118. 10.1111/j.1365-294X.1993.tb00005.x

  • 26

    GlassN. L.DonaldsonG. C. (1995). Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes.Appl. Environ. Microb.6113231330. 10.1128/AEM.61.4.1323-1330.1995

  • 27

    GuarnacciaV.GroenewaldJ. Z.PolizziG.CrousP. W. (2017). High species diversity in Colletotrichum associated with citrus diseases in Europe.Persoonia393250. 10.3767/persoonia.2017.39.02

  • 28

    GuerberJ. C.LiuB.CorrellJ. C.JohnstonP. R. (2003). Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility.Mycologia95872895. 10.2307/3762016

  • 29

    GuptaA.JaiswalA.PrachnadS. (2014). Quantitative structure activity relationship analysis of N-substituted phenazine-1-carboxamides analogs as anti-mycobacterial agents.Int. J. Pharm. Life Sci.532303240.

  • 30

    HanF.YanR.ZhangM.XiangZ.WuQ.LiJ. (2020). Synthesis and bioactivities of phenazine-1-carboxylic piperazine derivatives.Nat. Prod. Res.3412821287. 10.1080/14786419.2018.1556656

  • 31

    HanY. C.ZengX. G.XiangF. Y.RenL.ChenF. Y.GuY. C. (2016). Distribution and Characteristics of Colletotrichum spp. Associated with Anthracnose of Strawberry in Hubei, China.Plant Dis.1009961006. 10.1094/PDIS-09-15-1016-RE

  • 32

    HeL. F.LiX. X.GaoY. Y.LiB. X.MuW.LiuF. (2019). Characterization and Fungicide Sensitivity of Colletotrichum spp. from Different Hosts in Shandong.China. Plant Dis.1033443. 10.1094/PDIS-04-18-0597-RE

  • 33

    HuM.GrabkeA.DowlingM. E.HolsteinH. J.SchnabelG. (2015). Resistance in Colletotrichum siamense From Peach and Blueberry to Thiophanate-Methyl and Azoxystrobin.Plant Dis.99806814. 10.1094/PDIS-10-14-1077-RE

  • 34

    HuangL.LiQ.ZhangY.LiD.YeJ. (2016). Colletotrichum gloeosporioides sensu stricto Is a Pathogen of Leaf Anthracnose on Evergreen Spindle Tree (Euonymus japonicus).Plant Dis.100672678. 10.1094/PDIS-07-15-0740-RE

  • 35

    HuangL.ZhuY.YangJ.LiD.LiY.BianL.et al (2018). Shoot Blight on Chinese Fir (Cunninghamia lanceolate) is Caused by Bipolaris oryzae.Plant Dis.102500506. 10.1094/PDIS-07-17-1032-RE

  • 36

    HydeK. D.CaiL.CannonP. F.CrouchJ. A.CrousP. W.DammU.et al (2009). Colletotrichum - names in current use.Fungal Div.39147182.

  • 37

    JayawardenaR. S.HuangJ.JinB.YanJ.LiX.HydeK.et al (2016). An account of Colletotrichum species associated with strawberry anthracnose in China based on morphology and molecular data.Mycosphere711471163. 10.5943/mycosphere/si/2c/6

  • 38

    KimH.LeeK.ChaeJ. (2015). Postharvest Biological Control of Colletotrichum acutatum on Apple by Bacillus subtilis HM1 and the Structural Identification of Antagonists.J. Microbiol. Biotechn.2519541959. 10.4014/jmb.1507.07100

  • 39

    KonsueW.DethoupT.LimtongS. (2020). Biological Control of Fruit Rot and Anthracnose of Postharvest Mango by Antagonistic Yeasts from Economic Crops Leaves.Microorganisms8:317. 10.3390/microorganisms8030317

  • 40

    KumarS.StecherG.TamuraK. (2016). MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.Mol. Biol. Evol.3318701874. 10.1093/molbev/msw054

  • 41

    LiuF.CaiL.CrousP. W.DammU. (2014). The Colletotrichum gigasporum species complex.Persoonia338397. 10.3767/003158514X684447

  • 42

    LiuF.WangM.DammU.CrousP. W.CaiL. (2016). Species boundaries in plant pathogenic fungi: a Colletotrichum case study.BMC Evol. Biol.16:81. 10.1186/s12862-016-0649-5

  • 43

    LiuF.WeirB. S.DammU.CrousP. W.WangY.LiuB.et al (2015). Unravelling Colletotrichum species associated with Camellia: employing ApMat and GS loci to resolve species in the C. gloeosporioides complex.Persoonia356386. 10.3767/003158515X687597

  • 44

    LiuY.ChenP.ZhouM.WangT.FangS.ShangX.et al (2018a). Geographic Variation in the Chemical Composition and Antioxidant Properties of Phenolic Compounds from Cyclocarya paliurus (Batal) Iljinskaja Leaves.Molecules23:2440. 10.3390/molecules23102440

  • 45

    LiuY.FangS.ZhouM.ShangX.YangW.FuX. (2018b). Geographic variation in water-soluble polysaccharide content and antioxidant activities of Cyclocarya paliurus leaves.Ind. Crop. Prod.121180186. 10.1016/j.indcrop.2018.05.017

  • 46

    LoguaA. D.PalchykovskaL. H.KostinaV. H.SannaA.MeledduR.ChisuL.et al (2009). Novel N-aryl- and N-heteryl-phenazine-1-carboxamides as potential agents for the treatment of infections sustained by drug-resistant and MDR Mycobacterium tuberculosis.Int. J. Antimicrob. Ag.33223229. 10.1016/j.ijantimicag.2008.09.016

  • 47

    LuX. H.ZhuS. S.BiY.LiuX. L.HaoJ. J. (2010). Baseline Sensitivity and Resistance-Risk Assessment of Phytophthora capsici to Iprovalicarb.Phytopathology10011621168. 10.1094/PHYTO-12-09-0351

  • 48

    MaD.ZhuJ.HeL.CuiK.MuW.LiuF. (2018a). Baseline Sensitivity and Control Efficacy of Tetramycin Against Phytophthora capsici Isolates in China.Plant Dis.102863868. 10.1094/PDIS-09-17-1396-RE

  • 49

    MaD.ZhuJ.JiangJ.ZhaoY.LiB.MuW.et al (2018b). Evaluation of bioactivity and control efficacy of tetramycin against Corynespora cassiicola.Pestic. Biochem. Phys.152106113. 10.1016/j.pestbp.2018.09.009

  • 50

    ManireC. A.RhinehartH. L.SuttonD. A.ThompsonE. H.RinaldiM. G.BuckJ. D.et al (2002). Disseminated mycotic infection caused by Colletotrichum acutatum in a Kemp’s ridley sea turtle (Lepidochelys kempi).J. Clin. Microbiol.4042734280. 10.1128/JCM.40.11.4273-4280.2002

  • 51

    McGheeG. C.SundinG. W. (2011). Evaluation of kasugamycin for fire blight management, effect on nontarget bacteria, and assessment of kasugamycin resistance potential in Erwinia amylovora.Phytopathology101192204. 10.1094/PHYTO-04-10-0128

  • 52

    MiaoJ.DongX.LinD. (2015). Activity of the novel fungicide oxathiapiprolin against plant-pathogenic oomycetes.Pest Manage. Sci.7215721577. 10.1002/ps.4189

  • 53

    MoJ.ZhaoG.LiQ.SolangiG. S.TangL.GuoT.et al (2018). Identification and characterization of Colletotrichum species associated with mango anthracnose in Guangxi.China. Plant Dis.10212831289. 10.1094/PDIS-09-17-1516-RE

  • 54

    MoreiraR. R.May De MioL. L. (2015). Potential biological agents isolated from apple fail to control Glomerella leaf spot in the field.Biol. Control875663. 10.1016/j.biocontrol.2015.04.020

  • 55

    MunirM.AmsdenB.DixonE.VaillancourtL.GauthierN. A. W. (2016). Characterization of Colletotrichum Species Causing Bitter Rot of Apple in Kentucky Orchards.Plant Dis.10021942203. 10.1094/PDIS-10-15-1144-RE

  • 56

    O’DonnellK.NirenbergH. I.AokiT.CigelnikE. (2000). A Multigene phylogeny of the Gibberella fujikuroi species complex: Detection of additional phylogenetically distinct species.Mycoscience416178. 10.1007/BF02464387

  • 57

    O’ConnellR. J.ThonM. R.HacquardS.AmyotteS. G.KleemannJ.TorresM. F.et al (2012). Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses.Nat. Genet.4410601065. 10.1038/ng.2372

  • 58

    O’DonnellK.CigelnikE. (1997). Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous.Mol. Phylogenet. Evol.7103116. 10.1006/mpev.1996.0376

  • 59

    PalchykovskaL. G.VasylchenkoO. V.PlatonovM. O.KostinaV. G.BabkinaM. M.TarasovO. A.et al (2012). Evaluation of antibacterial and antiviral activity of N-arylamides of 9-methyl and 9-methoxyphenazine-1-carboxylic acids -inhibitors of the phage T7 model transctiption.Biopolym. Cell28477485. 10.7124/bc.00013A

  • 60

    PrihastutiH.CaiL.ChenH.McKenzieE. H. C.HydeK. D. (2009). Characterisation of Colletotrichum species associated with coffee berries in northern Thailand.Fungal Div.3989109.

  • 61

    RenJ.CuiY.ZhangF.CuiH.NiX.ChenF.et al (2014). Enhancement of nystatin production by redirecting precursor fluxes after disruption of the tetramycin gene from Streptomyces ahygroscopicus.Microbiol. Res.169602608. 10.1016/j.micres.2013.09.017

  • 62

    RonquistF.TeslenkoM.van der MarkP.AyresD. L.DarlingA.HohnaS.et al (2012). MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space.Syst. Biol.61539542. 10.1093/sysbio/sys029

  • 63

    SangeethaC. G.RawalR. D. (2008). Nutritional studies of Colletotrichum gloeosporioides (Penz.) Penz. and Sacc. the incitant of mango anthracnose.World J. Agric. Sci.4717720.

  • 64

    SharmaG.MaymonM.FreemanS. (2017). Epidemiology, pathology and identification of Colletotrichum including a novel species associated with avocado (Persea americana) anthracnose in Israel.Sci. Rep.7:15839. 10.1038/s41598-017-15946-w

  • 65

    SilvaD. N.TalhinhasP.VárzeaV.CaiL.PauloO. S.BatistaD. (2012). Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (Coffea spp.) hosts.Mycologia104396409. 10.3852/11-145

  • 66

    SimionatoA. S.NavarroM. O. P.de JesusM. L. A.BarazettiA. R.Da SilvaC. S.SimoesG. C.et al (2017). The Effect of Phenazine-1-Carboxylic Acid on Mycelial Growth of Botrytis cinerea Produced by Pseudomonas aeruginosa LV Strain.Front. Microbiol.8:1102. 10.3389/fmicb.2017.01102

  • 67

    SongY.HeL.ChenL.RenY.LuH.GengS.et al (2016). Baseline sensitivity and control efficacy of antibiosis fungicide tetramycin against Botrytis cinerea.Eur. J. Plant Pathol.146337347. 10.1007/s10658-016-0920-z

  • 68

    ThanP. P.JeewonR.HydeK. D.PongsupasamitS.MongkolpornO.TaylorP. W. J. (2008). Characterization and pathogenicity of Colletotrichum species associated with anthracnose on chilli (Capsicum spp.) in Thailand.Plant Pathol.57562572. 10.1111/j.1365-3059.2007.01782.x

  • 69

    UdayangaD.ManamgodaD. S.LiuX. Z.ChukeatiroteE.HydeK. D. (2013). What are the common anthracnose pathogens of tropical fruits?Fungal Diver.61165179. 10.1007/s13225-013-0257-2

  • 70

    UdumulaV.EndresJ. L.HarperC. N.JaramilloL.ZhongH. A.BaylesK. W.et al (2017). Simple synthesis of endophenazine G and other phenazines and their evaluation as anti-methicillin-resistant Staphylococcus aureus agents.Eur. J. Med. Chem.125710721. 10.1016/j.ejmech.2016.09.079

  • 71

    UppalaS.ZhouX. G. (2018). Field efficacy of fungicides for management of sheath blight and narrow brown leaf spot of rice.Crop Prot.1047277. 10.1016/j.cropro.2017.10.017

  • 72

    VieiraW. A. D.BezerraP. A.da SilvaA. C.VelosoJ. S.CamaraM. P. S.DoyleV. P.et al (2020). Optimal markers for the identification of Colletotrichum species.Mol. Phylogenet. Evol.143:106694. 10.1016/j.ympev.2019.106694

  • 73

    WangQ. H.FanK.LiD. W.HanC. M.QuY. Y.QiY. K.et al (2020). Identification, Virulence and Fungicide Sensitivity of Colletotrichum gloeosporioides s.s. Responsible for Walnut Anthracnose Disease in China.Plant Dis.10413581368. 10.1094/PDIS-12-19-2569-RE

  • 74

    WangQ.JiangC.FangS.WangJ.JiY.ShangX.et al (2013). Antihyperglycemic, antihyperlipidemic and antioxidant effects of ethanol and aqueous extracts of Cyclocarya paliurus leaves in type 2 diabetic rats.J. Ethnopharmacol.15011191127. 10.1016/j.jep.2013.10.040

  • 75

    WeirB. S.JohnstonP. R.DammU. (2012). The Colletotrichum gloeosporioides species complex.Stud. Mycol.73115180. 10.3114/sim0011

  • 76

    WhiteT. J.BrunsT.LeeS.TaylorJ. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: A Guide to Methods and Applications.New York: Academic Press

  • 77

    WikeeS.CaiL.PairinN.McKenzieE. H. C.SuY.ChukeatiroteE.et al (2011). Colletotrichum species from Jasmine (Jasminum sambac).Fungal Div.46171182. 10.1007/s13225-010-0049-x

  • 78

    XieJ.DongC.NieS.LiF.WangZ.ShenM.et al (2015). Extraction, chemical composition and antioxidant activity of flavonoids from Cyclocarya paliurus (Batal.) Iljinskaja leaves.Food Chem.18697105. 10.1016/j.foodchem.2014.06.106

  • 79

    XieJ.LiuX.ShenM.NieS.ZhangH.LiC.et al (2013). Purification, physicochemical characterisation and anticancer activity of a polysaccharide from Cyclocarya paliurus leaves.Food Chem.13614531460. 10.1016/j.foodchem.2012.09.078

  • 80

    XieJ.WangW.DongC.HuangL.WangH.LiC.et al (2018). Protective effect of flavonoids from Cyclocarya paliurus leaves against carbon tetrachloride-induced acute liver injury in mice.Food Chem. Toxicol.119392399. 10.1016/j.fct.2018.01.016

  • 81

    XieJ.XieM.NieS.ShenM.WangY.LiC. (2010). Isolation, chemical composition and antioxidant activities of a water-soluble polysaccharide from Cyclocarya paliurus (Batal.) Iljinskaja.Food Chem.11916261632. 10.1016/j.foodchem.2009.09.055

  • 82

    XieM. Y.LiL.NieS. P.WangX. R.LeeF. (2006). Determination of speciation of elements related to blood sugar in bioactive extracts from Cyclocarya paliurus leaves by FIA-ICP-MS.Eur. Food Res. Technol.223202209. 10.1007/s00217-005-0173-0

  • 83

    XueL.ZhangL.YangX. X.HuangX.WuW.ZhouX.et al (2019). Characterization, Phylogenetic Analyses, and Pathogenicity of Colletotrichum Species on Morus alba in Sichuan Provine, China.Plant Dis.10326242633. 10.1094/PDIS-06-18-0938-RE

  • 84

    ZhangJ.HuangN.LuJ.LiX.WangY.YangL.et al (2010). Water-soluble Phenolic Compounds and Their Anti-HIV-1 Activities from the Leaves of Cyclocarya paliurus.J. Food Drug Anal.18398404.

  • 85

    ZhaoX. H.ZhongL. J.ZhangQ. H. (2010). Effect of tetramycin on mycelial growth and spore germination of rice blast pathogen.J. Microbiol.304345.

  • 86

    ZhengX.ZhangM.ShangX.FangS.ChenF. (2020). Stem Canker on Cyclocarya paliurus Is Caused by Botryosphaeria dothidea.Plant Dis.10410321040. 10.1094/PDIS-11-18-1990-RE

  • 87

    ZhongL. J.ZhaoX. H.ZhangQ. H.XuC.ZhuH. L. (2010). Rice resistance against blast induced by tetramycin.Plant Dis. Pests168.

  • 88

    ZhuX.YuL. H.HsiangT.HuangD.XuZ. H.WuQ. L.et al (2019). The influence of steric configuration of phenazine-1-carboxylic acid-amino acid conjugates on fungicidal activity and systemicity.Pest Manag. Sci.7533233330. 10.1002/ps.5455

  • 89

    ZhuX.YuL.ZhangM.XuZ.YaoZ.WuQ.et al (2018). Design, synthesis and biological activity of hydroxybenzoic acid ester conjugates of phenazine-1-carboxylic acid.Chem. Cent. J.12110. 10.1186/s13065-018-0478-2

Summary

Keywords

Cyclocarya paliurus, etiology, fungicide sensitivity, Colletotrichum, anthracnose

Citation

Zheng X, Zhang M, Shang X, Fang S and Chen F (2021) Etiology of Cyclocarya paliurus Anthracnose in Jiangsu Province, China. Front. Plant Sci. 11:613499. doi: 10.3389/fpls.2020.613499

Received

02 October 2020

Accepted

28 December 2020

Published

18 January 2021

Volume

11 - 2020

Edited by

Sajeewa S. N. Maharachchikumbura, University of Electronic Science and Technology of China, China

Reviewed by

Gunjan Sharma, Agricultural Research Organization (ARO), Israel; Ruvishika Jayawardena, Mae Fah Luang University, Thailand

Updates

Copyright

*Correspondence: Feng-mao Chen,

This article was submitted to Plant Pathogen Interactions, a section of the journal Frontiers in Plant Science

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics