Merike Sõmera
Sébastien Massart
Lucie Tamisier
Pille Sooväli
Kanitha Sathees4
Anders Kvarnheden
94% of researchers rate our articles as excellent or good
Learn more about the work of our research integrity team to safeguard the quality of each article we publish.
Find out more
- 1Department of Chemistry and Biotechnology, Tallinn University of Technology, Tallinn, Estonia
- 2Laboratory of Integrated and Urban Phytopathology, Gembloux Agro-Bio Tech – University of Liège, Gembloux, Belgium
- 3Department of Plant Protection, Estonian Crop Research Institute, Jõgeva, Estonia
- 4Department of Plant Biology, Swedish University of Agricultural Sciences, Uppsala, Sweden
- 5Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Tartu, Estonia
A Corrigendum on
A Survey Using High-Throughput Sequencing Suggests That the Diversity of Cereal and Barley Yellow Dwarf Viruses Is Underestimated
by Sõmera, M., Massart, S., Tamisier, L., Sooväli, P., Sathees, K., and Kvarnheden, A. (2021). Front. Microbiol. 12:673218. doi: 10.3389/fmicb.2021.673218
In the original article, there was a typographical mistake in Table 1 as published. The sequence of Yan-R primer should read “TGTTGAGGAGTCTACCTATTTG”. The Yan-R primer sequence was given correct in the Supplementary Table 2. The correct Yan-R primer was used in experiments undertaken in this study and thus it does not impact on validity of the results. The corrected Table 1 appears below.
TABLE 1
Table 1. Primers used in the current study.
The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.
Publisher's Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
Liu, F., Wang, X., Liu, Y., Xie, J., Gray, S. M., Zhou, G., et al. (2007). A Chinese isolate of barley yellow dwarf virus-PAV represents a third distinct species within the PAV serotype. Arch. Virol. 152, 1365–1373. doi: 10.1007/s00705-007-0947-8
Keywords: HTS, Luteovirus, BYDV, CYDV, diagnostics, wheat, epidemiology, OYV
Citation: Sõmera M, Massart S, Tamisier L, Sooväli P, Sathees K and Kvarnheden A (2021) Corrigendum: A Survey Using High-Throughput Sequencing Suggests That the Diversity of Cereal and Barley Yellow Dwarf Viruses Is Underestimated. Front. Microbiol. 12:772637. doi: 10.3389/fmicb.2021.772637
Received: 08 September 2021; Accepted: 26 October 2021;
Published: 19 November 2021.
Approved by:
Frontiers Editorial Office, Frontiers Media SA, SwitzerlandCopyright © 2021 Sõmera, Massart, Tamisier, Sooväli, Sathees and Kvarnheden. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Merike Sõmera, bWVyaWtlLnNvbWVyYUB0YWx0ZWNoLmVl