Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira
- 1Department of Animal Microbiology, Graduate School of Agricultural Science, Tohoku University, Sendai, Japan
- 2Department of Bacteriology I, National Institute of Infectious Diseases, Tokyo, Japan
- 3Department of Applied Physics, Graduate School of Engineering, Tohoku University, Sendai, Japan
A Corrigendum on
Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira
by Xu, J., Koizumi, N., and Nakamura, S. (2020). Front. Microbiol. 11:1886. doi: 10.3389/fmicb.2020.01886
In the original article, there was a mistake in Supplementary Table S1 as published.
In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” was shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCATCCATG” is correct. The corrected Supplementary Table S1 appears below.
The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.
Publisher's Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Keywords: bacterial motility, pathogenicity, spirochete, leptospirosis, zoonosis, host–pathogen association, biophysics, optical microscopy
Citation: Xu J, Koizumi N and Nakamura S (2021) Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira. Front. Microbiol. 12:736406. doi: 10.3389/fmicb.2021.736406
Received: 05 July 2021; Accepted: 07 July 2021;
Published: 17 August 2021.
Approved by:
Frontiers Editorial Office, Frontiers Media SA, SwitzerlandCopyright © 2021 Xu, Koizumi and Nakamura. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Shuichi Nakamura, bmFrYSYjeDAwMDQwO2JwLmFwcGgudG9ob2t1LmFjLmpw
†Present address: Jun Xu, Department of Bacteriology, Graduate School of Medicine, University of the Ryukyus, Okinawa, Japan