ORIGINAL RESEARCH article

Front. Immunol., 30 November 2017

Sec. Multiple Sclerosis and Neuroimmunology

Volume 8 - 2017 | https://doi.org/10.3389/fimmu.2017.01701

Low-Density Lipoprotein Receptor Deficiency Attenuates Neuroinflammation through the Induction of Apolipoprotein E

  • 1. Biomedical Research Institute, Hasselt University, Diepenbeek, Belgium

  • 2. Molecular Cell Biology and Immunology, VU University Medical Center, Amsterdam, Netherlands

Abstract

Objective:

We aimed to determine the role of the low-density lipoprotein receptor (LDLr) in neuroinflammation by inducing experimental autoimmune encephalomyelitis (EAE) in ldlr knock out mice.

Methods:

MOG35–55 induced EAE in male and female ldlr−/− mice was assessed clinically and histopathologically. Expression of inflammatory mediators and apolipoprotein E (apoE) was investigated by qPCR. Changes in protein levels of apoE and tumor necrosis factor alpha (TNFα) were validated by western blot and ELISA, respectively.

Results:

Ldlr−/−-attenuated EAE disease severity in female, but not in male, EAE mice marked by a reduced proinflammatory cytokine production in the central nervous system of female ldlr−/− mice. Macrophages from female ldlr−/− mice showed a similar decrease in proinflammatory mediators, an impaired capacity to phagocytose myelin and enhanced secretion of the anti-inflammatory apoE. Interestingly, apoE/ldlr double knock out abrogated the beneficial effect of ldlr depletion in EAE.

Conclusion:

Collectively, we show that ldlr−/− reduces EAE disease severity in female but not in male EAE mice, and that this can be explained by increased levels of apoE in female ldlr−/− mice. Although the reason for the observed sexual dimorphism remains unclear, our findings show that LDLr and associated apoE levels are involved in neuroinflammatory processes.

Introduction

Multiple sclerosis (MS) is an inflammatory autoimmune demyelinating disease of the central nervous system (CNS). Infiltrated macrophages and resident microglia are considered the dominant effector cells in MS and its animal model, experimental autoimmune encephalomyelitis (EAE) (1, 2). Effector mechanisms include phagocytosis of myelin and the secretion of inflammatory and toxic mediators (37). However, increasing evidence indicates that phagocytes can also acquire a disease-resolving phenotype in the CNS. For instance, we recently defined that ingestion of myelin by macrophages alters the inflammatory phenotype by activating the cholesterol- and fatty acid-sensing nuclear liver X receptors and peroxisome proliferator-activated receptors (810). These studies stress the pleiotropic role that phagocytes play in the pathophysiology of MS and indicate that lipid-signaling pathways drive the phenotype of phagocytes in MS lesions.

The impact of cholesterol and its metabolites on the pathophysiology of MS is a topic of interest in MS-research (1116). In the MS brain, marked alterations in both myelin cholesterol and other lipid metabolites are found (13). Furthermore, plasma and cerebrospinal fluid (oxy)sterol levels are disturbed and closely correlate to neurodegenerative processes (1417). In addition, we showed that lipoprotein levels and function are altered in relapsing-remitting MS patients (RRMS), which may advance disease progression in these patients (18). More specifically, we found smaller low-density lipoprotein (LDL) particles in RRMS patients compared to healthy controls. Interestingly, the average LDL particle size was smaller in male RRMS patients compared to female RRMS patients, which suggests gender differences in lipid metabolism in MS. LDL size is described to be important for LDL function indicating the lipoprotein may be involved in the pathophysiology of disease. Smaller particles have an increased susceptibility to oxidation and a decreased LDL receptor (LDLr) affinity, which may promote their proinflammatory properties (1921).

The LDLr is a 160 kDa cell surface glycoprotein that plays a key role in plasma cholesterol homeostasis (22). It binds two physiologically important ligands, apolipoprotein B-100 (apoB) and apolipoprotein E (apoE). The only known ligand for the LDLr in the CNS is apoE since apoB is not synthesized in the CNS and, in contrast to apoE, cannot cross the blood–brain barrier (22). Malfunctioning of the receptor in humans results in familial hypercholesterolemia (FH) and is an important risk factor for cardiovascular disease (23). FH is caused by genetic mutations that directly or indirectly affect the function of the LDLr. It is characterized by defective catabolism of LDL, which results in increased plasma cholesterol concentrations and lipid accumulation in macrophages and other immune cells. This promotes proinflammatory responses, including enhanced NF-κB signaling, inflammasome activation, and increased production of neutrophils and monocytes in the bone marrow and spleen (2428). The ability of lipoproteins to modulate neuroinflammation has been suggested in recent studies (29, 30). In addition, elevated LDL plasma levels were found to increase neurotoxicity in a mouse model for Alzheimer’s disease (30). The above findings indicate that lipoproteins modulate neuroinflammation and neurodegeneration. However, the direct contribution of LDL and LDLr to these processes remains unclear.

Here, we determined the role of the LDLr in neuroinflammation by using the EAE model and ldlr knock out (ldlr−/−) mice. We show that ldlr deficiency reduces disease severity in female, but not in male EAE mice. In line with this finding, the inflammatory burden was significantly lower in the CNS of female ldlr−/− mice compared to ldlr−/− male mice. Macrophages isolated from female ldlr−/− mice show an altered inflammatory profile and an impaired capacity to phagocytose myelin. Interestingly, apoE release was enhanced in macrophages derived from females and the beneficial effect of ldlr deficiency in EAE was absent in apoE/ldlr double knock out mice. This shows that elevated apoE levels likely attenuate EAE severity in female ldlr−/− mice. Collectively, our findings indicate that changes in ldlr expression contribute to the progression of neuroinflammatory diseases in a gender-specific manner.

Materials and Methods

Animals

Ldlr−/− and apoE/ mice on a C57BL/6 background and C57BL/6 wild-type (WT) mice were purchased from Harlan Laboratories. Animals were fed a regular diet and housed in the animal facility of the Biomedical Research Institute of Hasselt University. All experiments were performed according to institutional guidelines and were approved by the ethical committee for animal experiments of Hasselt University.

Induction of EAE

Eleven-week-old mice were immunized subcutaneously at the base of the tail with 200 µg of recombinant human myelin oligodendrocyte glycoprotein MOG35–55 emulsified in 100 µl complete Freund’s adjuvant supplemented with 4 mg/ml of Mycobacterium tuberculosis (H37RA strain) according to manufacturer’s guidelines (Hooke Laboratories, Lawrence, USA). Within 2 h and after 22–26 h, mice were intraperitoneally injected with 0.1 ml pertussis toxin. Immunized mice were weighed and scored daily by following a five-point standardized rating of clinical symptoms: 0, no signs; 1, loss of tail tonus; 2, flaccid tail; 3, hind limb paresis; 4, hind limb paralysis; 5, death. Mice were sacrificed at day 18 (peak) and at day 27 post immunization.

Peritoneal Macrophage Cultures

Mice were injected intraperitoneally with 1.5 ml phosphate-buffered saline (PBS, Sigma-Aldrich) supplemented with 5 mM ethylenediamine teraacetic acid (EDTA, VWR, Leuven, Belgium). Peritoneal cells were cultured for 3 h in RPMI-1640 medium (Lonza, Verviers, Belgium), enriched with 10% fetal calf serum (FCS; Hyclone, Erembodegem, Belgium), 0.5% penicillin/streptomycin (P/S Invitrogen, Merelbeke, Belgium), in a 24-well plate (5 × 104 cells/well) at 37°C with 5% CO2. Cells were stimulated for 18 h with 100 ng/ml lipopolysaccharide (LPS; Sigma-Aldrich) to assess their gene expression. Medium was stored for protein measurement.

T Cell Proliferation

Spleen and inguinal lymph nodes (LN) were isolated from mice 9 days after EAE induction. T cells were isolated from LN and spleen and cultured in RPMI medium containing 20 µM β-mercaptoethanol, 2% mouse serum, 1% non-essential amino acids, 1% sodium pyruvate, 0.5% P/S. Cells were plated in a 96-well plate at a density of 3 × 105 cells/well and subsequently stimulated with 10 µg/ml MOG for 48 h. Next, 1μCi [3H] thymidine (Amersham biosciences, UK) was added for 18 h after which cells were collected using an automatic cell harvester (Pharmacia, Uppsala, Sweden). A β plate liquid scintillation counter (Perkin Elmer, lifesciences, Wellesly, MA, USA) was used to quantify radioactivity and results are expressed as stimulation index (SI). The SI shows the relative proliferation of MOG-stimulated T cells compared to non-stimulated T cells (SI = 1).

Quantitative PCR (qPCR)

RNA was extracted from tissue or cells using the RNeasy mini kit (Qiagen, Venlo, The Netherlands). In short, lysis was performed with Qiazol Lysis reagent (Qiagen) supplemented with 1% β-mercaptoethanol (Sigma-Aldrich). RNA concentration and quality were determined with a Nanodrop spectrophotometer (Isogen Life Science, The Netherlands). cDNA synthesis was conducted using the Quanta qScript cDNA synthesis kit (Quanta Biosciences, Boston, MA, USA) per manufacturer’s instructions. qPCR was performed on a StepOnePlus™ Real-Time PCR system (Applied biosystems, Ghent, Belgium) using the SYBR green method (Applied Biosystems). The master mix contained 1× SYBR green, 10 µM primers, 12.5 ng cDNA, and nuclease free water. Data were normalized to the most stable reference genes and the ΔΔCt method was used to determine relative quantification of gene expression. Primers were designed using NCBI’s Primer-blast (details are shown in Table 1).

Table 1

GeneSequence (5′–3′)Product size (bp)Accession number
apoE forwardACTGGGTCGCTTTTGGGATT64NM_000041.2
apoE reverseCTCCTCCTGCACCTGCTCA
Tnfα forwardCCAGACCCTCACACTCAG79NM_013693.3
Tnfα reverseCACTTGGTGGTTTGCTACGAC
iNOS forwardGGCAGCCTGTGAGACCTTTG150NM_010927.3
iNOS reverseGCATTGGAAGTGAAGCGTTTC
IL-6 forwardTGTCTATACCACTTCACAAGTCGGAG79NM_001314054.1
IL-6 reverseGCACAACTCTTTTCTCATTTCCAC
Ywhaz forwardGCAACGATGTACTGTCTCTTTTGG149NM_001253807.1
Ywhaz reverseGTCCACAATTCCTTTCTTGTCATC
Pgk1 forwardGAAGGGAAGGGAAAAGATGC138NM_008828.3
Pgk1 reverseGCTATGGGCTCGGTGTGC
Rpl13a forwardGGATCCCTCCACCCTATGACA131NM_009438.5
Rpl13a reverseCTGGTACTTCCACCCGACCTC
Ywhaz forwardGCAACGATGTACTGTCTCTTTTGG149NM_001253807.1
Ywhaz reverseGTCCACAATTCCTTTCTTGTCATC
T-bet forwardCCATGTGACCCAGATGATCG87NM_019507.2
T-bet reverseTCTGGCTCTCCATCATTCAC
GATA3 forwardCTGCGGACTCTACCATAA114NM_001355111.1
GATA3 reverseGTGGTGGTCTGACAGTTC
RORγt forwardGGATGAGATTGCCCTCTA141NM_011281.3
RORγt reverseCCTTGTCGATGAGTCTTG
Foxp3 forwardCCCAGGAAAGACAGCAACCTT133NM_001199347.1
Foxp3 reverseCTGCTTGGCAGTGCTTGAGAA
IL-12 forwardTCATCAGGGACATCATCAAACC210NM_001303244.1
IL-12 reverseCGAGGAACGCACCTTTCTG
Arg1 forwardGTGAAGAACCCACGGTCTGT132NM_007482.3
Arg1 reverseGCCAGAGATGCTTCCAACTG
IL-17 forwardATCAGGACGCGCAAACATGA125NM_010552.3
IL-17 reverseTTGGACACGCTGAGCTTTGA
IL-4 forwardCTCACAGCAACGAAGAACACCA148NM_021283.2
IL-4 reverseAAGCCCGAAAGAGTCTCTGCA
IFNγ forwardTGAGGTCAACAACCCACAGGT104NM_008337.4
IFNγ reverseGACTCCTTTTCCGCTTCCTGAG

Mouse primers for RT-qPCR.

NO Production

Peritoneal macrophages in culture were stimulated with 100 ng/ml LPS (Sigma-Aldrich) prior to the assay. NO production was determined in the supernatant of peritoneal macrophages using a Griess-reagent assay (Promega, Leuven, Belgium) according to the manufacturer’s instructions.

Immunohistochemistry

Animals were perfused transcardially through the ventricular catheter with ringer (containing heparin). Spinal cord tissue was isolated, snap-frozen, and sectioned with a Leica CM1900UV cryostat (Leica Microsystems, Wetzlar, Germany) to obtain 8 µm slices. Dried cryosections were fixed in acetone for 10 min and subsequently blocked for 0.5 h with 10% normal serum. Cryosections were incubated overnight at 4°C with primary antibodies. Next, secondary antibodies were added for 1 h. Primary antibodies used were rat anti-mouse CD3 (1:150; AbD Serotec) and rat anti-mouse F4/80 (1:100; AbD Serotec). Goat anti-rat Alexa Fluor®555 (1:400; Invitrogen) was used as a secondary antibody. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:2,500; Sigma-Aldrich). Stained sections were visualized under a Nikon Eclipse 80i fluorescence microscope (Nikon, Kingston, UK). Sections were analyzed using NIS Elements viewer software 4.0 (Nikon).

Western Blot

Apolipoprotein E secretion by peritoneal macrophages was determined using western blot. Culture medium was collected and separated via sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Gels were transferred to a PVDF-membrane (VWR, Leuven, Belgium) and blots were blocked for 1 h in TBS-Tween 5% non-fat dry milk. Membranes were probed with mouse anti-apoE (Abbiotec, Antwerpen, Belgium). After washing steps with TBS-Tween, blots were incubated with horseradish peroxidase-labeled anti-mouse antibody (Dako, Heverlee, Belgium). Immunoreactive signals were detected with Enhanced Chemiluminescence (ECL Plus, GE Healthcare, Diegem, Belgium).

Phagocytosis Assay

Myelin was isolated from brain tissue of healthy adult WT C57BL/6 OlaHSD mice (Harlan) by means of sucrose density gradient centrifugation, as previously described (31). Next, myelin was labeled with the lypophilic dye 1,1′-Dioctadecyl-3,3,3′,3′-Tetramethylindocarbocyanine Perchlorate (DiI) (Thermofisher Scientific, Erembodegem, Belgium). Peritoneal macrophages were incubated with DiI labeled myelin (25 µg/ml) for 90 min at 37°C and 5% CO2. Next, cells were rinsed with PBS (Sigma-Aldrich), detached with PBS/EDTA and resuspended in FACS buffer containing 1× PBS, 2% FCS (Hyclone) and sodium Azide. The fluorescent internalized myelin was measured using the FACS Calibur flow cytometer (BD biosciences, Erembodegem, Belgium). Results are expressed as mean fluorescence.

ELISA

Peritoneal mouse macrophages were stimulated with 100 ng/ml LPS for 18 h prior to the assay. TNFα concentration in peritoneal macrophage culture supernatant was determined using the TNFα Mouse Uncoated ELISA Kit (Thermofisher), following the manufacturer’s instructions. Absorption was measured at 450 nm using a microtiterplate reader (Biorad, Temse, Belgium).

Statistical Analysis

Data were statistically analyzed using GraphPad Prism for windows (version 5.0) and are reported as mean ± SEM. D’Agostino and Pearson omnibus normality test was used to test Gaussian distribution. A two-tailed unpaired student t-test was used for normally distributed data sets [t(df); P]. The Mann–Whitney analysis (MWU, n1, n2; P) was used for data sets that did not pass normality. EAE scores were analyzed using two-way ANOVA (Bonferroni’s post hoc multiple comparison test). *p < 0.05, **p < 0.01, and ***p < 0.001.

Results

Ldlr Deficiency Reduces EAE Severity in Female But Not in Male Mice

To elucidate whether the LDLr contributes to neuroinflammation, we induced EAE in male and female ldlr−/− mice. We show that ldlr deficiency has a sex-specific effect on the EAE course. Female ldlr−/− mice exhibited a decreased EAE disease severity compared to WT mice, whereas in male mice ldlr deficiency did not affect EAE disease severity (Figures 1A,B). In female animals, the mean peak of disease symptoms was reached around day 17. The mean disease score was attenuated in ldlr−/− (1.504 ± 0.1995) compared to WT (2.318 ± 0.1782) mice (Figure 1C). Accordingly, the maximum disease score was lower in LDLr−/− (1.70 ± 0.30) compared to WT (2.68 ± 0.29) mice (Figure 1D). The ldlr−/− and WT groups displayed a similar day of onset (14.29 ± 1.04 and 12.41 ± 0.34, respectively Figure 1E).

Figure 1

Ldlr Deficiency Has No Significant Influence on Immune Cell Infiltration into the CNS

Experimental autoimmune encephalomyelitis is characterized by the infiltration of peripheral immune cells into the CNS leading to a local inflammatory response. To determine whether this process is altered by ldlr deficiency in female mice, the accumulation of T cells (CD3) and macrophages (F4/80) in the CNS of WT and ldlr deficient female EAE mice was assessed by immunohistochemistry at day 18 and day 33 post immunization (Figure 2; Figures S1 and S2 in Supplementary Material). Despite a reduced disease severity, no significant differences in the number of infiltrated macrophages and T cells into the spinal cord tissue were observed comparing female WT EAE mice and ldlr-deficient EAE mice, although a trend on day 18 is visible.

Figure 2

Ldlr Deficiency in Female Mice Has No Influence on T Cell Proliferation

T cell proliferation is an important hallmark of EAE and is essential for the initiation of EAE pathogenesis. Since T cells are dependent on cholesterol in order to proliferate (32), we investigated the influence of ldlr on T cell proliferation during EAE. T cells from both ldlr−/− and WT mice were isolated on day 9 post immunization and a thymidine assay was used to determine their proliferation capacity. No significant differences in T cell proliferation between ldlr−/− and WT mice induced with EAE (Figure 3A). In addition, we determined mRNA expression of transcription factors such as T-bet, GATA3, RORγt, and Foxp3, which are involved in T cell differentiation into Th1, Th2, Th17, and Treg subsets, in LN and spleen but found no difference between ldlr−/− and WT female mice (Figures 3B,C). Lastly, we analyzed the mRNA expression levels of cytokines important in T cell differentiation (IFNγ, IL-4, IL-17, and IL-10) in T cells isolated from both spleen and LN. No differences in the gene expression of these cytokines were observed. The mRNA levels of IL-4 and IL-17 were not detectable. Data are shown in the supplementary section (Figure S3 in Supplementary Material). Together, these results indicate that altered T cell proliferation and differentiation do not account for the reduced EAE in ldlr deficient mice.

Figure 3

Ldlr Deficiency Reduces Inflammation in the Spinal Cord of Female Mice Compared to Male Mice

Our data indicate that ldlr deficiency in female mice attenuates EAE severity without affecting T cell proliferation and the level of immune cell infiltration into the CNS. To further define the inflammatory burden in the CNS, whole spinal cord tissue of male and female ldlr−/− mice was analyzed for mRNA expression of proinflammatory genes. Female ldlr−/− mice exhibited a significantly lower expression of tumor necrosis factor alpha (Tnfα), Interleukin-6 (IL-6), and nitric oxide synthase (iNOS) compared to male ldlr−/− mice and female WT mice (Figures 4A,B), whereas the expression of these inflammatory genes is not changed in male ldlr−/− mice (Figure 4C). These data indicate that female ldlr−/− mice have decreased inflammation in the spinal cord compared to male ldlr−/− and female WT mice.

Figure 4

Ldlr Deficiency Suppresses the Inflammatory Phenotype of Macrophages in Female Mice

As the ldlr is highly expressed on macrophages and we observed a reduced expression of cytokines typically released by macrophages in female ldlr−/− EAE mice, we investigated the influence of ldlr deficiency on the inflammatory phenotype of macrophages in vitro. We found that female LPS-stimulated ldlr−/− macrophages produce less TNFα and NO compared to macrophages isolated from WT females (Figures 5A,B). In addition, we show that macrophages isolated from ldlr−/− female mice less efficiently internalize myelin compared to macrophages isolated from WT females (Figure 5C). Interestingly, expression of lrp1, a major receptor involved in the phagocytosis of myelin (33), was reduced as well (Figure 5D). The expression of the proinflammatory genes Tnfα, IL-6 and Il-12 is reduced in ldlr−/− female mice, whereas the anti-inflammatory gene Arg1 is increased in macrophages isolated from ldlr−/− female mice compared to WT mice (Figures 5E–I). These data indicate that macrophages isolated from female ldlr−/− mice have an attenuated inflammatory response upon stimulation and have a reduced phagocytosis capacity compared to their WT counterparts.

Figure 5

ApoE Expression Is Increased in Activated Peritoneal Macrophages Isolated from ldlr−/− Female Mice

Apolipoprotein E is known to induce an anti-inflammatory phenotype in macrophages (34). Interestingly, we show that ApoE mRNA expression is significantly increased in activated peritoneal macrophages from ldlr−/− female mice compared to both male ldlr−/− mice and female WT mice (Figures 6A–C). Next, we used Western blot to determine the amount of apoE secreted into the culture medium. We found that only LPS-stimulated macrophages isolated from female ldlr−/− mice, and not those from WT and male ldlr−/− mice, secreted significant levels of apoE (Figure 6D). These data suggest that ldlr deficiency in female mice is responsible for the increase and subsequent secretion of apoE by macrophages.

Figure 6

Lack of apoE Abrogates the Reduced Neuroinflammatory Response in Female ldlr/ Mice

To define to what extend an increase in apoE accounts for the observed reduction in EAE disease severity in ldlr−/− female mice and the observed less-inflammatory phenotype of macrophages isolated from these mice, we crossbred apoE−/−and ldlr−/− mice. In contrast to female ldlr−/− mice, female apoE−/−ldlr−/− mice did not exhibit an attenuated EAE disease course compared to WT mice (Figure 7A). In addition, the observed decreased capacity to phagocytose myelin and produce TNFα by macrophages from ldlr/ female mice was counteracted by depletion of apoE (Figures 7B,C). Interestingly, the impairment in NO production observed in ldlr−/− macrophages was also present in apoE−/−ldlr−/− macrophages indicating apoE is not accountable for this effect (Figure 7D). ApoE−/− alone did not alter EAE severity in female mice compared to WT mice (Figure 7E). These data indicate that the lack of apoE largely restores the impaired inflammatory response induced by ldlr deficiency in female mice and that the effect of ldlr−/− on NO production is not responsible for the ameliorated disease course in these mice.

Figure 7

Discussion

In this study, we show that ldlr−/− attenuates neuroinflammation in female but not in male EAE mice, and that macrophages isolated from female mice have an attenuated inflammatory response and reduced phagocytic capacity. Interestingly, apoE deficiency counteracts the impact of ldlr deficiency in females on the course and pathology of EAE. These findings indicate that an increased apoE expression in macrophages apoE in female ldlr−/− mice is at least partially responsible for the observed reduction in EAE severity.

We show that ldlr deficiency in female mice decreases the inflammatory burden in the CNS but does not affect T cell proliferation and differentiation, and immune cell infiltration into the CNS. However, the levels of proinflammatory mediators in the CNS were reduced in these mice and isolated macrophages showed an impaired inflammatory response. These findings suggest that ldlr deficiency affects the inflammatory and phagocytic properties of macrophages, thereby altering EAE disease severity. In concordance, levels of the proinflammatory markers Tnfα, IL-6, and Il-12 were reduced while an increased gene expression of the anti-inflammatory marker Arg1 was observed in macrophages isolated from ldlr−/− female mice compared to WT macrophages. Moreover, ldlr deficiency decreases macrophage mediated myelin phagocytosis and expression of lrp1. LRP1 is a member of the LDLr family that also functions as a scavenger receptor and has been shown to be directly involved in myelin phagocytosis (33). Myelin degradation and phagocytosis by macrophages enhances demyelination which leads to neurological symptoms in MS (3). Although speculative, it is possible that lack of ldlr results in decreased Lrp1 expression, thereby indirectly impairing myelin phagocytosis. Together, an altered macrophage response at least partially accounts for the beneficial effects of ldlr deficiency on EAE severity.

In contrast to the reduction in EAE severity in ldlr−/− mice, the clinical outcome was not altered in apoE−/−ldlr−/− mice. Activated peritoneal macrophages isolated from ldlr−/− female mice significantly increased apoE expression compared to WT or their male counterparts and, the beneficial effect of ldlr deficiency on myelin phagocytosis and TNFα production was absent in apoE−/−ldlr−/− macrophages. Although the LDLr is described to directly regulate apoE levels in the CNS (35), we found no elevated apoE gene expression in the CNS of ldlr−/− EAE mice (data not shown). Studies have reported that increased expression of apoE leads to a less-inflammatory phenotype in macrophages by downregulating M1-like and upregulating M2-like markers. In addition, apoE suppresses microglial activation and the release of TNFα (34, 36, 37). Furthermore, treatment of EAE animals with apoE-derived peptides ameliorates the clinical course of EAE and apoE deficiency exacerbates EAE by increasing immune reactivity and hampering CNS repair mechanisms (38, 39). These findings suggest that the LDLr suppresses ApoE expression thereby exacerbating neuroinflammatory responses in females.

The reason for the sexual dimorphism in apoE expression remains elusive. It is reported that apoE exerts moderate sex-specific effects on neuroinflammation. Schrewe and coworkers found that the EAE disease course was slightly attenuated in male apoE−/− mice, whereas EAE was more severe in female apoE−/− mice compared to WT mice. In our hands apoE−/− did not alter EAE disease outcome in female mice compared to WT mice. Methodological differences (e.g., immunization protocol) may explain these discrepancies. Moreover, in Schrewe’s study differences between WT and apoE/ female mice were only visible after 30–36 days post immunization, whereas our experiment lasted for up to 22 days post immunization. Nevertheless, the question remains why only macrophages from ldlr−/− female mice abundantly secrete apoE. Macrophages express receptors for sex hormones such as estrogen and testosterone and these hormones modulate macrophage activity (40, 41). Interestingly, administration of estrogens has been shown to directly regulate hepatic LDLr activity in human cells in vitro and 17β-estradiol increases the expression of apoE during the maturation stage of human monocytes to macrophages (4244). As lack of LDLr has been shown to increase apoE levels also (35), both mechanisms may contribute to the increased apoE levels observed in female ldlr/ mice.

However, it remains to be elucidated whether sex hormones are exclusively responsible for the observed effects. Studies investigating plasma lipid and lipoprotein concentrations across the menstrual cycle in women report virtually no variation (4547), and those that do, report only small reductions in LDL during the luteal phase and no changes in plasma triglyceride or HDL concentrations (45, 46). Therefore, the sexual dimorphism in lipid metabolism and its impact on neuroinflammation appears to be the result of an intricate network of sex hormones in combination with other modulators of lipid metabolism. The key pathways and mediators of this network remain to be elucidated, but there are many other factors involved such as insulin and adipokines (48), and gene expression and imprinting (49), that need to be explored in the future.

In addition to apoE, differences in female and male mice may be the result of differences in LDLr levels and function. However, there are few studies about sex-related differences in LDLr behavior. Segatto and coworkers determined age- and sex-related differences in extra-hepatic LDLr expression and found that LDLr protein expression was decreased in 12-month-old (onset of menopause) female rat brains, which was completely restored by estrogen treatment. In skeletal muscle, LDLr levels were increased in both male and female aged rats, whereas in the heart no modifications were observed either in aged rats or rats of a specific gender (50). These data illustrate the complex age- and sex-related and tissue-specific regulation of LDLr expression, and warrant the need of more research to clarify the implications of these differences for neuroinflammatory diseases and other conditions involving the LDLr.

Collectively, we show that ldlr−/− attenuates EAE disease severity in female but not in male EAE mice. Although the nature of the observed sexual dimorphism remains unclear, our findings show that LDLr and associated apoE levels are involved in neuroinflammatory diseases such as multiple sclerosis, which may have implications for future treatment strategies.

Statements

Ethics statement

Experiments were conducted in according to institutional guidelines and were approved by the ethical committee on animal experiments (ECAE) of Hasselt University.

Author contributions

JM, ST, KN, JV, TV, and JB performed the experiments and analyzed the data. JM wrote the manuscript. JM, ST, KN, JV, TV, JB, JH, and JH participated in the design and coordination of the project.

Acknowledgments

We would like to thank Joke Vanhoof and Katrien Wauterickx for excellent technical assistance. This work was supported by the Scientific Research-Flanders (FWO) (Grants 1506916N & 1512314N and 1264114N) and the Agentschap voor Innovatie van Wetenschap en Technologie (IWT) (Grant 131086).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at http://www.frontiersin.org/article/10.3389/fimmu.2017.01701/full#supplementary-material.

Figure S1

Fluorescent staining of macrophages (F4/80) in experimental autoimmune encephalomyelitis spinal cord. Staining of macrophages in wild-type female (A,C) and ldlr−/− female mice (B,D) on days 18 and 33, respectively.

Figure S2

Fluorescent staining of T cells (CD3) in experimental autoimmune encephalomyelitis spinal cord. Staining of T cells in wild-type female (A,C) and ldlr−/− female mice (B,D) on day 18 and 33, respectively.

Figure S3

Cytokine important in T cell differentiation. mRNA expression levels of cytokines important in T cell differentiation (IFNγ, IL-4, IL-17, and IL-10) in T cells isolated from both spleen and lymph nodes from WT and ldlr−/− female mice (n = 4). No differences in the gene expression of these cytokines were observed. The mRNA levels of IL-4 and IL-17 were not detectable.

References

  • 1

    HuitingaIRuulsSRJungSVan RooijenNHartungHPDijkstraCD. Macrophages in T cell line-mediated, demyelinating, and chronic relapsing experimental autoimmune encephalomyelitis in Lewis rats. Clin Exp Immunol (1995) 100(2):34451.10.1111/j.1365-2249.1995.tb03675.x

  • 2

    BrosnanCFBornsteinMBBloomBR. The effects of macrophage depletion on the clinical and pathologic expression of experimental allergic encephalomyelitis. J Immunol (1981) 126(2):61420.

  • 3

    HendriksJJTeunissenCEde VriesHEDijkstraCD. Macrophages and neurodegeneration. Brain Res Brain Res Rev (2005) 48(2):18595.10.1016/j.brainresrev.2004.12.008

  • 4

    BarnettMHHendersonAPPrineasJW. The macrophage in MS: just a scavenger after all? Pathology and pathogenesis of the acute MS lesion. Mult Scler (2006) 12(2):12132.10.1191/135248506ms1304rr

  • 5

    WilliamsKUlvestadEWaageAAntelJPMcLaurinJ. Activation of adult human derived microglia by myelin phagocytosis in vitro. J Neurosci Res (1994) 38(4):43343.10.1002/jnr.490380409

  • 6

    BogieJFMailleuxJWoutersEJorissenWGrajchenEVanmolJet alScavenger receptor collectin placenta 1 is a novel receptor involved in the uptake of myelin by phagocytes. Sci Rep (2017) 7:44794.10.1038/srep44794

  • 7

    BogieJFStinissenPHendriksJJ. Macrophage subsets and microglia in multiple sclerosis. Acta Neuropathol (2014) 128(2):191213.10.1007/s00401-014-1310-2

  • 8

    BogieJFTimmermansSHuynh-ThuVAIrrthumASmeetsHJGustafssonJAet alMyelin-derived lipids modulate macrophage activity by liver X receptor activation. PLoS One (2012) 7(9):e44998.10.1371/journal.pone.0044998

  • 9

    MailleuxJVanmierloTBogieJFWoutersELutjohannDHendriksJJet alActive liver X receptor signaling in phagocytes in multiple sclerosis lesions. Mult Scler (2017).10.1177/1352458517696595

  • 10

    BogieJFJorissenWMailleuxJNijlandPGZelcerNVanmierloTet alMyelin alters the inflammatory phenotype of macrophages by activating PPARs. Acta Neuropathol Commun (2013) 1:43.10.1186/2051-5960-1-43

  • 11

    SaherGBruggerBLappe-SiefkeCMobiusWTozawaRWehrMCet alHigh cholesterol level is essential for myelin membrane growth. Nat Neurosci (2005) 8(4):46875.10.1038/nn1426

  • 12

    Weinstock-GuttmanBZivadinovRMahfoozNCarlEDrakeASchneiderJet alSerum lipid profiles are associated with disability and MRI outcomes in multiple sclerosis. J Neuroinflammation (2011) 8:127.10.1186/1742-2094-8-127

  • 13

    GiubileiFAntoniniGDi LeggeSSormaniMPPantanoPAntoniniRet alBlood cholesterol and MRI activity in first clinical episode suggestive of multiple sclerosis. Acta Neurol Scand (2002) 106(2):10912.10.1034/j.1600-0404.2002.01334.x

  • 14

    TeunissenCEDijkstraCDPolmanCHHoogervorstELvon BergmannKLutjohannD. Decreased levels of the brain specific 24S-hydroxycholesterol and cholesterol precursors in serum of multiple sclerosis patients. Neurosci Lett (2003) 347(3):15962.10.1016/S0304-3940(03)00667-0

  • 15

    van de KraatsCKillesteinJPopescuVRijkersEVrenkenHLutjohannDet alOxysterols and cholesterol precursors correlate to magnetic resonance imaging measures of neurodegeneration in multiple sclerosis. Mult Scler (2014) 20(4):4127.10.1177/1352458513499421

  • 16

    LeoniVMastermanTDiczfalusyUDe LucaGHillertJBjorkhemI. Changes in human plasma levels of the brain specific oxysterol 24S-hydroxycholesterol during progression of multiple sclerosis. Neurosci Lett (2002) 331(3):1636.10.1016/S0304-3940(02)00887-X

  • 17

    MandojCRennaRPlantoneDSperdutiICiglianaGContiLet alAnti-annexin antibodies, cholesterol levels and disability in multiple sclerosis. Neurosci Lett (2015) 606:15660.10.1016/j.neulet.2015.08.054

  • 18

    JorissenWWoutersEBogieJFVanmierloTNobenJPSviridovDet alRelapsing-remitting multiple sclerosis patients display an altered lipoprotein profile with dysfunctional HDL. Sci Rep (2017) 7:43410.10.1038/srep43410

  • 19

    de GraafJHak-LemmersHLHectorsMPDemackerPNHendriksJCStalenhoefAF. Enhanced susceptibility to in vitro oxidation of the dense low density lipoprotein subfraction in healthy subjects. Arterioscler Thromb (1991) 11(2):298306.10.1161/01.ATV.11.2.298

  • 20

    ChancharmeLTherondPNigonFLepageSCouturierMChapmanMJ. Cholesteryl ester hydroperoxide lability is a key feature of the oxidative susceptibility of small, dense LDL. Arterioscler Thromb Vasc Biol (1999) 19(3):81020.10.1161/01.ATV.19.3.810

  • 21

    BerneisKKKraussRM. Metabolic origins and clinical significance of LDL heterogeneity. J Lipid Res (2002) 43(9):136379.10.1194/jlr.R200004-JLR200

  • 22

    BrownMSGoldsteinJL. A receptor-mediated pathway for cholesterol homeostasis. Science (1986) 232(4746):3447.10.1126/science.3513311

  • 23

    MiyakeYTajimaSFunahashiTYamamotoA. Analysis of a recycling-impaired mutant of low density lipoprotein receptor in familial hypercholesterolemia. J Biol Chem (1989) 264(28):1658490.

  • 24

    SheedyFJGrebeARaynerKJKalantariPRamkhelawonBCarpenterSBet alCD36 coordinates NLRP3 inflammasome activation by facilitating intracellular nucleation of soluble ligands into particulate ligands in sterile inflammation. Nat Immunol (2013) 14(8):81220.10.1038/ni.2639

  • 25

    TriantafilouMMiyakeKGolenbockDTTriantafilouK. Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation. J Cell Sci (2002) 115(Pt 12):260311.

  • 26

    SwirskiFKNahrendorfM. Leukocyte behavior in atherosclerosis, myocardial infarction, and heart failure. Science (2013) 339(6116):1616.10.1126/science.1230719

  • 27

    TolaniSPaglerTAMurphyAJBochemAEAbramowiczSWelchCet alHypercholesterolemia and reduced HDL-C promote hematopoietic stem cell proliferation and monocytosis: studies in mice and FH children. Atherosclerosis (2013) 229(1):7985.10.1016/j.atherosclerosis.2013.03.031

  • 28

    FengYSchoutedenSGeenensRVan DuppenVHerijgersPHolvoetPet alHematopoietic stem/progenitor cell proliferation and differentiation is differentially regulated by high-density and low-density lipoproteins in mice. PLoS One (2012) 7(11):e47286.10.1371/journal.pone.0047286

  • 29

    Jurukovska-NospalMArsovaVLevchanskaJSidovska-IvanovskaB. Effects of statins (atorvastatin) on serum lipoprotein levels in patients with primary hyperlipidemia and coronary heart disease. Prilozi (2007) 28(2):13748.

  • 30

    de OliveiraJMoreiraELdos SantosDBPiermartiriTCDutraRCPintonSet alIncreased susceptibility to amyloid-beta-induced neurotoxicity in mice lacking the low-density lipoprotein receptor. J Alzheimers Dis (2014) 41(1):4360.10.3233/JAD-132228

  • 31

    NortonWTPodusloSE. Myelination in rat brain: changes in myelin composition during brain maturation. J Neurochem (1973) 21(4):75973.10.1111/j.1471-4159.1973.tb07520.x

  • 32

    DimeloeSBurgenerAVGrahlertJHessC. T-cell metabolism governing activation, proliferation and differentiation; a modular view. Immunology (2017) 150(1):3544.10.1111/imm.12655

  • 33

    GaultierAWuXLe MoanNTakimotoSMukandalaGAkassoglouKet alLow-density lipoprotein receptor-related protein 1 is an essential receptor for myelin phagocytosis. J Cell Sci (2009) 122(Pt 8):115562.10.1242/jcs.040717

  • 34

    BaitschDBockHHEngelTTelgmannRMuller-TidowCVargaGet alApolipoprotein E induces antiinflammatory phenotype in macrophages. Arterioscler Thromb Vasc Biol (2011) 31(5):11608.10.1161/ATVBAHA.111.222745

  • 35

    FryerJDDemattosRBMcCormickLMO’DellMASpinnerMLBalesKRet alThe low density lipoprotein receptor regulates the level of central nervous system human and murine apolipoprotein E but does not modify amyloid plaque pathology in PDAPP mice. J Biol Chem (2005) 280(27):257549.10.1074/jbc.M502143200

  • 36

    LaskowitzDTThekdiADThekdiSDHanSKMyersJKPizzoSVet alDownregulation of microglial activation by apolipoprotein E and apoE-mimetic peptides. Exp Neurol (2001) 167(1):7485.10.1006/exnr.2001.7541

  • 37

    ChristensenDJOhkuboNOddoJVan KaneganMJNeilJLiFet alApolipoprotein E and peptide mimetics modulate inflammation by binding the SET protein and activating protein phosphatase 2A. J Immunol (2011) 186(4):253542.10.4049/jimmunol.1002847

  • 38

    LiFQSempowskiGDMcKennaSELaskowitzDTColtonCAVitekMP. Apolipoprotein E-derived peptides ameliorate clinical disability and inflammatory infiltrates into the spinal cord in a murine model of multiple sclerosis. J Pharmacol Exp Ther (2006) 318(3):95665.10.1124/jpet.106.103671

  • 39

    KarussisDMichaelsonDMGrigoriadisNKorezynADMizrachi-KollRChapmanSet alLack of apolipoprotein-E exacerbates experimental allergic encephalomyelitis. Mult Scler (2003) 9(5):47680.10.1191/1352458503ms950oa

  • 40

    TrigunaiteADimoJJorgensenTN. Suppressive effects of androgens on the immune system. Cell Immunol (2015) 294(2):8794.10.1016/j.cellimm.2015.02.004

  • 41

    Garcia-OvejeroDVeigaSGarcia-SeguraLMDoncarlosLL. Glial expression of estrogen and androgen receptors after rat brain injury. J Comp Neurol (2002) 450(3):25671.10.1002/cne.10325

  • 42

    SemenkovichCFOstlundREJr. Estrogens induce low-density lipoprotein receptor activity and decrease intracellular cholesterol in human hepatoma cell line Hep G2. Biochemistry (1987) 26(16):498792.10.1021/bi00390a016

  • 43

    SmithPMCowanAWhiteBA. The low-density lipoprotein receptor is regulated by estrogen and forms a functional complex with the estrogen-regulated protein ezrin in pituitary GH3 somatolactotropes. Endocrinology (2004) 145(7):307583.10.1210/en.2004-0228

  • 44

    NapolitanoMBlottaIMontaliABravoE. 17beta-estradiol enhances the flux of cholesterol through the cholesteryl ester cycle in human macrophages. Biosci Rep (2001) 21(5):63752.10.1023/A:1014721026280

  • 45

    MumfordSLSchistermanEFSiega-RizAMBrowneRWGaskinsAJTrevisanMet alA longitudinal study of serum lipoproteins in relation to endogenous reproductive hormones during the menstrual cycle: findings from the BioCycle study. J Clin Endocrinol Metab (2010) 95(9):E805.10.1210/jc.2010-0109

  • 46

    BarnettJBWoodsMNLamon-FavaSSchaeferEJMcNamaraJRSpiegelmanDet alPlasma lipid and lipoprotein levels during the follicular and luteal phases of the menstrual cycle. J Clin Endocrinol Metab (2004) 89(2):77682.10.1210/jc.2003-030506

  • 47

    MagkosFPattersonBWMittendorferB. No effect of menstrual cycle phase on basal very-low-density lipoprotein triglyceride and apolipoprotein B-100 kinetics. Am J Physiol Endocrinol Metab (2006) 291(6):E12439.10.1152/ajpendo.00246.2006

  • 48

    Perez-LopezFRLarrad-MurLKallenAChedrauiPTaylorHS. Gender differences in cardiovascular disease: hormonal and biochemical influences. Reprod Sci (2010) 17(6):51131.10.1177/1933719110367829

  • 49

    KimAMTingenCMWoodruffTK. Sex bias in trials and treatment must end. Nature (2010) 465(7299):6889.10.1038/465688a

  • 50

    SegattoMTrapaniLMarinoMPallottiniV. Age- and sex-related differences in extra-hepatic low-density lipoprotein receptor. J Cell Physiol (2011) 226(10):26106.10.1002/jcp.22607

Summary

Keywords

neuroinflammation, multiple sclerosis, experimental autoimmune encephalomyelitis, low-density lipoprotein receptor, apolipoprotein E

Citation

Mailleux J, Timmermans S, Nelissen K, Vanmol J, Vanmierlo T, van Horssen J, Bogie JFJ and Hendriks JJA (2017) Low-Density Lipoprotein Receptor Deficiency Attenuates Neuroinflammation through the Induction of Apolipoprotein E. Front. Immunol. 8:1701. doi: 10.3389/fimmu.2017.01701

Received

11 September 2017

Accepted

17 November 2017

Published

30 November 2017

Volume

8 - 2017

Edited by

Fabienne Brilot, University of Sydney, Australia

Reviewed by

Iain Comerford, University of Adelaide, Australia; Robert Adam Harris, Karolinska Institute (KI), Sweden

Updates

Copyright

*Correspondence: Jerome J. A. Hendriks,

Specialty section: This article was submitted to Multiple Sclerosis and Neuroimmunology, a section of the journal Frontiers in Immunology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics