ORIGINAL RESEARCH article

Front. Ecol. Evol., 28 March 2022

Sec. Ecophysiology

Volume 10 - 2022 | https://doi.org/10.3389/fevo.2022.716018

New Insight on Vitality Differences for the Penaeid Shrimp, Fenneropenaeus chinensis, in Low Salinity Environment Through Transcriptomics

  • JL

    Jun Liu 1*

  • DZ

    Daizhen Zhang 2

  • LZ

    Lei Zhang 1

  • ZW

    Zhengfei Wang 2

  • JS

    Jie Shen 1*

  • 1. Lianyungang Key Laboratory of Biotechnology, Lianyungang Normal College, Lianyungang, China

  • 2. Jiangsu Key Laboratory for Bioresources of Saline Soils, Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, Jiangsu Synthetic Innovation Center for Coastal Bio-Agriculture, Yancheng Teachers University, Yancheng, China

Abstract

Excessive rainfall changes salinity in shrimp farming ponds in short period and exerts low salinity stress on the outdoor breeding shrimp under global warming. Fenneropenaeus chinensis can have different performance on vitality in low salinity environments. To reveal mechanisms of vitality difference in shrimp living in low saline environments. This study based on the normal and moribund F. chinensis in 10 ppt salinity environment using high-throughput sequencing identifies 1,429 differentially expressed genes (DEGs), 586 of which are upregulated, while 843 of which are downregulated in the normal group (FCN10) as compared to the moribund group (FCM10). Meanwhile, another transcriptomic analysis is conducted on the normal and moribund shrimp from 25 ppt (FCN25 vs. FCM25) salinity environment as the control, in which 1,311 DEGs (upregulated: 327 genes, downregulated: 984 genes) are identified. In this study, intersective pathways, GO (Gene Ontology) categories and DEGs from the two groups of comparative transcriptome are investigated. The two intersective pathways (Metabolism of xenobiotics by cytochrome P450, Pentose, and glucuronate interconversions) significantly enriched by DEGs are related to detoxification. In these two pathways, there is one vitality regulation-related gene (VRRG), the Dhdh (dihydrodiol dehydrogenase), which is upregulated in both the groups of FCN10 and FCN25 as compared to the groups of FCM10 and FCM25, respectively. Similarly, in the 25 top intersective GO categories, four VRRGs are revealed. Three of them are upregulated (Itgbl, kielin/chordin-like protein, Slc2a8, solute carrier family 2, facilitated glucose transporter member 8-like protein and Cyp3a30, cytochrome P450 3A30-like protein); one of them is downregulated (Slc6a9, sodium-dependent nutrient amino acid transporter 1-like protein isoform X2). These GO categories are related to transmembrane transporter activity of substance, enzyme inhibitor activity, monooxygenase activity. RT-qPCR analysis further verifies the VRRGs. The study gives new insight into understanding the vitality differences for F. chinensis, in low salinity environment. The pathways and DEGs in response to low salinity stress in modulating the vitality of F. chinensis that could serve as tools in future genetic studies and molecular breeding.

Introduction

The thermodynamic and kinetic constrained climate system under global warming accelerated the global hydrological cycle. In this case, the salinity in the upper oceans in the northern hemisphere is significantly fresher (Du et al., 2019). In addition, in China from 1961 to 2015, heavy rain and total heavy rainfall showed an increasing trend, with rainfall and rainy day trends of 127.02 and 463.94 mm per year and 7.93 and 4.24 days per year, respectively (Kong, 2019). Excessive rainfall not only changes the pH levels of shrimp farming ponds, but although changes salinity in the ponds in short period of time (He et al., 2019).

In countries such as China, freshwater aquaculture is increasingly important to the sustainable development of the shrimp fishing industry (Cao et al., 2017), the study and breeding of euryhaline marine species with low-salinity resistance is necessary. For example, the Pacific white shrimp (Litopenaeus vannamei), a species that is reported to be capable of surviving in a large range of salinities and that has been cultured in freshwater habitats (Yuan et al., 2021). According to Florkin and Schoffeniels (1969), two fundamental physiological mechanisms in marine organisms that are used to cope with changes in environmental salinity are (1) isosmotic intracellular volume regulation (Mechanism 1), and (2) anisosmotic extracellular osmoregulation (Mechanism 2). Based on these mechanisms, shrimp can be classified into two categories, the osmoconformers and osmoregulators; the former via Mechanism 1 mainly include marine species that cannot resist the stress of low salinity, while the latter group including some marine species with Mechanism 2 have stronger ability to resist the stress of low salinity (below 26 ppt, Henry et al., 2012). At present, additional mechanisms of salinity variability response have been reported, such as the osmoregulation of ion transporting epithelia and differential expression of some biomolecules in the gill epithelial cells (Henry et al., 2012). These biomolecules include Na+/K+-ATPase, K+ channels, Cl channels, carbonic anhydrase (CA), aquaporins (AQPs), and various exchangers (Na+/NH4+, Na+/H+, and Cl/HCO3) (Neufeld and Pritchard, 1979; Henry and Cameron, 1982; Varley and Greenaway, 1994; Henry, 2001; Chung et al., 2012; Henry et al., 2012). These genes could be potential target tools for breeding of high quality stocks better adapted to salinity variability (Abdelrahman et al., 2017).

Fenneropenaeus chinensis, similar to L. vannamei that is another economically important penaeid shrimp, naturally distributes in regions of relatively narrow salinity compared to L. vannamei and cannot be cultured in freshwater yet (Yuan et al., 2021). A recent research has identified different phenotypes of these two osmoregulators (L. vannamei and F. chinensis) under low-salinity stress related to their response effectiveness (Yuan et al., 2021). L. vannamei seems to have a more rapid response to low-salinity stress, and differentially expressed genes (DEGs) have been found by comparing these penaeid shrimp based on transcriptomic methods. All studies mentioned above will surely be of benefit to understanding osmoregulation mechanisms of adaptation to salinity stress for these penaeid shrimp, but they are insufficient for understanding the mechanisms of vitality differences for shrimp living in a given salinity environment (i.e., some individuals alive and well, but others moribund). The vitality of individuals is associated with the survival of the shrimp and has a significant impact on harvest yield (Whiting et al., 2000).

A previous study used L. vannamei with normal and moribund shrimp to investigate the genetic mechanisms associated with the susceptibility to viruses (Yao et al., 2018). F. chinensis can also present vitality differences in a given low salt environment, however in the background of breeding by experience, few studies have considered the mechanism of vitality differences in F. chinensis (Gao et al., 2014; Li et al., 2019; Meng et al., 2019; Lu et al., 2020). These studies suggest that some key biomolecules exist to modulate the vitality of F. chinensis in low salinity environment. To reveal these key biomolecules, the present study aimed to analyze the differences in gene expression between groups of normal and moribund shrimp from two salinity environments (low salinity: 10 ppt, the control: 25 ppt) using transcriptomic methods (RNA-seq). The goal was to explain why some individuals in a certain salinity environment thrive, while others are moribund. The study thus identifies potential genes in pathways or GO terms for further investigation of genetic diversity and breeding programs.

Materials and Methods

Sample Collection and Treatment

From July to August 2020, live shrimp were obtained from a farming pool in Lianyungang (N 34°48′52.47″, E 119°12′19.08″) and transported to our laboratory at Lianyungang Normal College. All shrimp were acclimated to a salinity of 25 ppt, the natural isosmotic point of this species (Chen and Lin, 1994; Chen et al., 1995), at 25°C for 24 h. We then randomly divided the shrimp into two groups (n = 100 per group): one group was exposed to low salinity levels (10 ppt) for 4 days, while the other group remained at 25 ppt salinity (the control) for acclimation. On the fifth day, the gills of 12 randomly selected individuals per group were harvested (6 normal shrimp from 10 ppt salinity environment, FCN10; 6 moribund shrimp from 10 ppt salinity environment, FCM10; 6 normal shrimp from 25 ppt salinity environment, FCN25; 6 moribund shrimp from 25 ppt salinity environment, FCM25). In our recent project, 48 samples were sequenced, 24 of which were randomly used in this study (25 ppt: mean body length: 10.40 ± 0.60 cm, normal; 10.78 ± 0.70 cm, moribund; 10 ppt: mean body length: 11.30 ± 0.21 cm, normal; 10.46 ± 0.25 cm, moribund). The gills were stored at −70°C for transcriptome and real-time quantitative PCR (RT-qPCR) analysis.

In the study, salinity was maintained using sea salt and pure water and measured by a portable salinity meter (Arcevoos® ST6). In each tank, 50 L of water was used, and one-third was replaced every 12 h (7:00–19:00).

RNA Isolation, Library Construction, and Sequencing

Total RNA was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, United States). RNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States), and RNA integrity was assessed using 1.5% agarose gel electrophoresis. Magnetic oligo (dT) beads were used to isolate mRNA from total RNA. The mRNA was then broken into fragments approximately 200 bps long using fragmentation buffer (Tris-acetate, KOAc, and MgOAc) at 94°C for 35 min. The fragmented mRNA was used to construct the cDNA libraries. At least 5 μL of mRNA solution (≥200 ng/μL) was used to construct each library. Sequencing libraries for each sample were generated using the TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, United States). Libraries were paired-end sequenced using a NovaSeq 6000 platform (Illumina, San Diego, CA, United States). The read length was 300 bps.

Transcriptome Assembly and Unigene Annotation

Raw sequence data were processed using FastqStat.jar V1.0 (Cock et al., 2010) with default parameters. We then used Cutadapt v1.161 (Martin, 2011) with parameters -q 20 -m 20 to clean the raw sequence data by deleting adapter sequences, deleting poly-N sequences, trimming low-quality sequence ends (<Q20), deleting sequences with N ratios > 10%, and removing reads less than 25 bps long. We used Trinity2 (Haas et al., 2013) to assemble the clean reads with default parameters. The longest transcript in each gene cluster defined by Trinity was selected as a unigene for downstream analysis (Leung et al., 2014).

The identified unigenes were annotated against six databases, namely, NCBI non-redundant sequences (NR), Kyoto Encyclopedia of Genes and Genomes Ortholog (KEGG), Gene Ontology (GO), Protein family (PFAM), functional protein association networks (STRING), and a manually annotated and reviewed protein sequence database (SWISS-PROT). We searched the unigenes against these databases using BlastX v2.2.25 (Altschul et al., 1990) with a cutoff E-value of 10––5. Functional unigenes were identified based on GO terms using Blast2GO3 (Conesa et al., 2005).

Identification and Enrichment of Differentially Expressed Unigenes

We used Kallisto v0.43.14 to evaluate the expression levels of the unigenes based on transcripts per kilobase of exon per million reads (TPM) values; higher TPM values reflect higher levels of unigene expression (Li and Dewey, 2011). We used edgeR v3.24 to identify unigenes where | log2 fold change (FC)| was >1 and the false discovery rate (FDR) was <0.05 (Reiner et al., 2003; Trapnell et al., 2013); these unigenes were considered DEGs. We then identified the KEGG pathways and GO terms significantly enriched in the DEGs (p < 0.05) using hypergeometric tests (Li et al., 2014).

Verification of Differentially Expressed Unigenes Using Real-Time Quantitative PCR

We conducted RT-qPCR validation to common target DEGs, which were from the two comparisons (the normal vs. moribund in the 10 ppt and 25 ppt salinity groups). We used the TubA gene (α-tubulin) as the internal reference gene (Kozera and Rapacz, 2013), and it was stably expressed in the study. Gene-specific primers were designed based on sequences derived from the transcriptome assembly and annotation using Primer Premier 5.0 (Lalitha, 2000) (Table 1). For the synthesis of cDNA the HiScript 1st Strand cDNA Synthesis Kit was used. Each RT-qPCR (10 μL) contained 5 μL of 2 × SYBR qPCR Mix, 0.5 μL each of forward and reverse primers, 2 μL of cDNA, and 2 μL of RNase-free H2O. RT-qPCRs were performed on an Real-time PCR system (Bio-Rad, CFX96, United States), with the following cycling conditions: an initial denaturation step of 5 min at 95°C; 44 cycles of 10 s at 95°C, 30 s at 60°C; and a standard dissociation cycle. Three technical replicates were performed per gene, and the 2–ΔΔCT method (Wang et al., 2013) was used to calculate relative expression levels (relative quantification).

TABLE 1

Gene descriptionForward primer sequence (5′–3′)Reverse primer sequence (5′–3′)Product length (bp)
α-tubulin (TubA)CTACGAGGAGGTCGGAGTGGTGCTTCGGAGACGGTTGTT176
Kielin/chordin-like protein (Itgbl)GTGCAGCAAACCCTCGAAGAAAATAACGCCGTGGACATA187
Solute carrier family 2, facilitated glucose transporter member 8-like (Slc2a8)AAGAGGGGAAAGGGAACAAGTCGAACACGAACGCTGAAA198
Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase-like (Dhdh)AAGTAGGCTGAGGCAAGGAAATGAATAGGAAGCGGTTGAATG159
Cytochrome P450 3A30-like (Cyp3a30)CCAACCGCCCAAAACTCGTCCCTGCCATGTGCTTCAT138
Sodium-dependent nutrient amino acid transporter 1-like isoform X2 (Slc6a9)CAAAGCCGAGCCTCTGAAAGCATGACCTCCACCACGA122

Primers used for real-time quantitative PCR.

Results

Assembling of Transcriptomic Data and Annotation

After raw data filtering, our project yielded a total of 267.074 Gb bases from the transcriptomic sequencing of 48 samples. The 24 samples used in this study with the values of 98.35% and 45.74% for Q20 and GC content, respectively, were investigated for potential genes and pathways in modulating the vitality of F. chinensis (Table 2). We assembled all the 48 sequences into one transcriptomic map. Assembling results of unigenes and transcripts yielded total sequence numbers of 585,478 and 715,339; the GC content was 42.47 and 42.63%; the N50 values were 686 bps and 1,216 bps with average lengths of 576 bps and 772 bps, respectively (Table 3).

TABLE 2

Sample IDTotal readsTotal basesQ20 (%)GC content (%)
FCN25-147,808,6746,885,716,82798.1942.91
FCN25-244,595,7266,380,496,29097.8844.35
FCN25-354,588,0667,855,462,62598.1443.75
FCN25-437,594,2485,373,968,09898.4146.95
FCN25-539,759,8345,702,746,38398.5247.32
FCN25-637,477,0005,332,358,37598.0947.19
FCM25-161,167,7308,786,736,72698.1244.90
FCM25-262,058,1868,991,207,68798.5941.41
FCM25-345,550,9746,55,6571,47598.1043.50
FCM25-442,742,1866,131,663,57198.5647.76
FCM25-539,083,6545,607,110,41698.5148.27
FCM25-637,944,3245,450,543,45998.4348.16
FCN10-151,857,0907,470,240,74098.1245.00
FCN10-244,181,1906,378,915,96398.2645.24
FCN10-350,320,4507,225,661,56798.1845.38
FCN10-439,522,3885,683,903,73698.5247.62
FCN10-542,763,0206,120,508,01698.5046.68
FCN10-639,557,9905,653,265,11198.5246.40
FCM10-130,844,7104,469,453,63098.6639.87
FCM10-255,095,3147,937,343,22898.5044.09
FCM10-341,251,8625,901,513,07498.0346.85
FCM10-441,616,9565,932,371,86498.4747.61
FCM10-541,391,7285,927,942,85598.5348.46
FCM10-642,995,7886,153,200,76598.4748.03
Average44,657,045.336,412,870,93798.3545.74

Statistics of clean reads.

Each group had six replicates. FCN10, Normal F. chinensis in 10 ppt salinity environment; FCM10, Moribund F. chinensis in 10 ppt salinity environment; FCN25, Normal F. chinensis in 25 ppt salinity environment; FCM25, Moribund F. chinensis in 25 ppt salinity environment.

TABLE 3

TypeUnigenesTranscripts
Total sequence number585,478715,339
Total sequence base337,187,078552,241,490
Percent GC (%)42.4742.63
Largest (bps)30,94630,946
Smallest (bps)201183
Average (bps)575.92772
N50 (bps)6861,216
N90 (bps)270307

Profile of assembling.

Annotation of the 585,478 unigenes using 6 databases showed that the frequency for each database from large to small was as follows: NR (68,239, 11.66%), KEGG (35,183, 6.01%), PFAM (34,683, 5.92%), SWISS-PROT (27,089, 4.63%), GO (26,983, 4.61%), and STRING (4,363, 0.75%). In the study, 1,253 of the unigenes were annotated against all of the databases, accounting for only 0.21%. The unigenes accounting for 83.75% were annotated in at least one database. Regarding the species distribution, 26.5% of the distinct sequences showed top matches with sequences from the Penaeus monodon and Penaeus vannamei (synonyms of L. vannamei) (Figure 1).

FIGURE 1

Identification of the Differentially Expressed Unigenes and Enrichment

After quantification of unigenes with TPM values, there were 1,429 DEGs between groups of FCN10 and FCM10 (Figure 2A) and 1,311 DEGs between FCN25 and FCM25 based on the criteria of |log2FC| > 1 and FDR < 0.05 (Figure 2B). Between the two groups of FCN10 and FCM10, 586 DEGs were upregulated for the group FCN10, while FCN10 had 843 downregulated DGEs as compared to the FCM10 group. Between the two groups of FCN25 and FCM25, 327 DEGs were upregulated for the group FCN25, while FCN25 had 984 downregulated DEGs compared to the FCM25 group.

FIGURE 2

Enrichment of DEGs based on KEGG and GO showed that 14 of pathways were significantly enriched in the comparison of 10 salinity groups (FCN10 vs. FCM10). Six of pathways were significantly enriched in the comparison of 25 salinity groups (FCN25 vs. FCM25). 335 of GO terms were significantly enriched in the comparison of 10 salinity groups, 216 of GO terms were significantly enriched in the comparison of 25 salinity groups (Supplementary Table 1). The main pathways include Ribosome, Pentose and glucuronate interconversions, Metabolism of xenobiotics by cytochrome P450, Cell adhesion molecules (CAMs), ECM-receptor interaction, Arachidonic acid metabolism. The main GO terms include External encapsulating structure, Extracellular matrix, Structural molecule activity, Cuticle development, D-amino acid transport, D-amino acid transmembrane transporter activity, L-amino acid transmembrane transporter activity, Organic acid transmembrane transporter activity, Carboxylic acid transmembrane transporter activity, Monooxygenase activity, Amino acid: sodium symporter activity, Organic acid: sodium symporter activity, Amino acid: cation symporter activity, Anion transmembrane transporter activity, Neutral amino acid transmembrane transporter activity, Secondary active transmembrane transporter activity, Solute: sodium symporter activity, Oxidoreductase activity.

Notably, two of the pathways (Metabolism of xenobiotics by cytochrome P450, ko00980; Pentose and glucuronate interconversions, ko00040) were significantly enriched by DEGs from both comparisons, i.e., FCN10 vs. FCM10, and FCN25 vs. FCM25 (Supplementary Table 2). In GO databases, 60 terms were significantly enriched by DEGs from both comparisons, and here the detail information of the top 25 GO terms (adjust p-value < 0.05) were shown in Figure 3 and Supplementary Table 2. Most of them were related to transmembrane transporter activity of substance. Others included enzyme inhibitor activity (GO: 0004857), monooxygenase activity (GO: 0004497).

FIGURE 3

Identification of Potential Vitality-Related Differentially Expressed Unigenes From Pathways and Gene Ontology Terms (Categories)

In the present study, 9 of DEGs for the both groups in 10 ppt (FCN10 vs. FCM10) and 25 ppt (FCN25 vs. FCM25) salinity environments had the same expression pattern (Table 4). The results showed that seven of them were upregulated (Tim2l, mitochondrial import inner membrane translocase subunit Tim21-like protein; Itgbl, kielin/chordin-like protein; SORD, sorbitol dehydrogenase-like; Slc2a8, solute carrier family 2, facilitated glucose transporter member 8-like; Dhdh, trans-1,2-dihydrobenzene-1,2-diol dehydrogenase-like; Cyp3a30, cytochrome P450 3A30-like; Urocl, urocanate hydratase-like) and two of them were downregulated (Slc6a9, sodium-dependent nutrient amino acid transporter 1-like isoform X2; Rackl, guanine nucleotide-binding protein subunit beta-like protein isoform X2). Five of the 9 DEGs (Itgbl, Slc2a8, Dhdh, Cyp3a30, Slc6a9) enriched in the two KEGG pathways (Metabolism of xenobiotics by cytochrome P450; Pentose and glucuronate interconversions) and the top 25 GO terms (Supplementary Table 2).

TABLE 4

No.SymbolGenes’ descriptionlog2FC1log2FC2Upregulated/
Downregulated
1TRINITY_DN0_c0_g1XP_037783062.1 mitochondrial import inner membrane translocase subunit Tim21-like protein, TIM216.185.56Up
2TRINITY_DN1160_c0_g1XP_037802014.1 kielin/chordin-like protein, Itgbl, CD291.702.37Up
3TRINITY_DN13256_c0_g1XP_037798245.1 sorbitol dehydrogenase-like protein, SORD, gutB2.132.60Up
4TRINITY_DN1806_c0_g1XP_037779521.1 solute carrier family 2, facilitated glucose transporter member 8-like protein, Slc2a8, GLUT81.923.42Up
5TRINITY_DN3998_c0_g1XP_027227808.1 trans-1,2-dihydrobenzene-1,2-diol dehydrogenase-like protein, Dhdh1.602.06Up
6TRINITY_DN70493_c0_g1XP_037798812.1 cytochrome P450 3A30-like protein, Cyp3a301.431.30Up
7TRINITY_DN8415_c0_g3XP_037784188.1 urocanate hydratase-like protein, UROC11.422.40Up
8TRINITY_DN1647_c0_g5XP_037773511.1 sodium-dependent nutrient amino acid transporter 1-like protein isoform X2, Slc6a9−1.19−1.60Down
9TRINITY_DN802_c0_g1XP_018323985.1 guanine nucleotide-binding protein subunit beta-like protein isoform X2, RACK1−3.58−2.29Down

Differentially expressed genes (DEGs) with the same expression pattern in the both comparisons, i.e., FCN10 vs. FCM 10 and FCN25 vs. FCM 25.

1From the comparison of FCN10 vs. FCM10.

2From the comparison of FCN25 vs. FCM25.

Real-Time Quantitative PCR Verification

We used RT-qPCR to further verify the potential vitality-related DEGs. All these genes had similar expression patterns in both the RT-qPCR and the RNA-Seq analyses (Figure 4). Genes of Itgbl, Slc2a8, Dhdh, Cyp3a30 were upregulated in normal shrimp compared to moribund shrimp, while Slc6a9 was downregulated.

FIGURE 4

Discussion

Stress of aquatic animals occurs due to physical and physiological disturbances in the certain aquatic environment (Eissa and Wang, 2014; Yu et al., 2016). For example, fishes living in alkaline water, which with the high pH, they will suffer stress from inhibition of ammonia excretion and increasing CO2 excretion in physiology (Yao et al., 2012). Response ability to stress is closely related to vitality regulation in organisms (Eissa and Wang, 2014). In this study, two pathways and 60 GO terms were significantly enriched by DEGs from comparisons (the normal shrimp vs. the moribund shrimp) in both salinity environments (10 ppt and 25 ppt). Notably, the two pathways and the top 25 GO terms were enriched by five of DEGs (Itgbl, Slc2a8, Dhdh, Cyp3a30, Slc6a9), which had the same expression pattern in the comparisons from both the salinities. The expression patterns of the five target genes had also been verified by the results of RT-qPCR. Thus, our study based on two tests of transcriptomic comparisons from two salinity environments identified potential pathways (GO terms) and genes involved in vitality regulation for further investigation of genetic diversity and breeding programs, and these genes may be served as bio-indicator of shrimp health status.

Salt-induced stress is one of the hot issues in stress response induced by environmental factors in aquatic animals. In the crustacean species, the pathway of metabolism of xenobiotics by cytochrome P450 significantly enriched in this study is important in the biotransformation and detoxification of xenobiotics (e.g., hydrocarbons, pesticides, drugs) and endogenous compounds (e.g., fatty acids, eicosenoids, steroids) as it does in bacteria and vertebrates to stress response (James and Boyle, 1998; Snyder, 2000). Similarly, the pathway of pentose and glucuronate interconversions could also involve in stress response (Yao et al., 2012). In the progress of response to toxic substances, whether oxidized, reduced or hydrolyzed, compounds mostly conjugated with toxic substances, such as glucuronide conjugation in the pentose and glucuronate interconversion pathways, which plays an important role in detoxification by masking toxic groups and therefore will change the physical and chemical properties of toxic substances (Sun et al., 2018). These two significant pathways in this study indicated that detoxification of F. chinensis contributes to their vitality regulation. In this study, no other xenobiotic substances were added in water of shrimp living, except for sea salt. Shrimp in normal group and moribund group lived in the same condition, thus their physiological difference ought to be attributed to the difference on individual genetic properties. We found that in the two pathways, Dhdh was upregulated in the normal shrimp compared to the moribund shrimp from both the salinity environments (Table 4). Dhdh encodes dihydrodiol dehydrogenases, which have been implicated in the detoxication of carcinogenic metabolites such as polycyclic aromatic hydrocarbons (Penning, 1993). Deng et al. (2002) showed that increased expression of dihydrodiol dehydrogenase could induce resistance to Cisplatin in human ovarian carcinoma cells. Although, the pathway of cytochrome P450 were paid more attention by researchers (Rewitz et al., 2006; Koenig et al., 2012), less information was available for Dhdh in crustacean species. Thus, this gene deserves more attention in future for its potential application in vitality regulation.

In this study, genes of Itgbl, Slc2a8, and Cyp3a30 were upregulated in the normal shrimp compared to the moribund shrimp from both the salinity environments, while Slc6a9 was downregulated based on GO terms (Table 4). Differential expression (upregulation and downregulation) of all these genes in shrimp seem to have effects on their vitality. Previous studies demonstrated that bone morphogenetic proteins (BMPs), the low molecular weight secreted glycoproteins in invertebrates (Lelong et al., 2001), could function in inflammatory responses, cell proliferation and differentiation, angiogenesis and apoptosis (Vinuesa et al., 2015). In this context, it was reported that the kielin/chordin-like protein (KCP, Itgbl) could regulate the BMP signaling pathways (Ye et al., 2018). The differential expression of the Itgbl in different cell components including extracellular matrix, integral component of membrane, intrinsic component of membrane, integral component of plasma membrane and intrinsic component of plasma membrane (Supplementary Table 2), thus we conclude that Itgbl regulates vitality of the shrimp via the versatility of it. However, as to our knowledge, studies about this gene of crustacean is absent recently.

In shrimp and crab, as the one of the integral components of membrane, the glucose transporter member 8 (GLUT8) encoded by Slc2a8 is involved in carbohydrate metabolism and glucose transport (Tollefsen et al., 2017). The recent study by Seo et al. (2018) showed that metabolic shift from glycogen to trehalose was facilitated in promoting lifespan and healthspan in Caenorhabditis elegans. Actually, Alava and Pascual (1987) had ever pointed that trehalose and sucrose diets can promote higher survival rates of Penaeus monodon than glucose diets, they believed that trehalose at the certain level in diets can better meet the energy needs to spare protein for shrimp growth. Moreover, in autophagy-lysosome system, trehalose was found to have the ability to cause autophagy-lysosome biogenesis response, which is important in cellular degradation pathway that recycles dysfunctional organelles and cytotoxic protein aggregates thus make organisms healthy (Jeong et al., 2021). Therefore, differential expression of the Slc2a8 (downregulated) in moribund shrimp compared to the normal shrimp in this study may imply its disruption to trehalose synthesis, which could support the opinion that trehalose is helpful to promote lifespan, healthspan and survival rates of invertebrates (Seo et al., 2018). The vitality regulation of Slc2a8 in F. chinensis is considered to be associated with trehalose metabolism in this study.

Glycine transporter 1 (Slc6a9) belongs to members of the Na+/Cl-dependent neurotransmitter transporter superfamily, and it plays a role in response to oxidative challenge (Rees et al., 2006; Howard et al., 2010). Recently a study showed that Slc6a9 was upregulated in Procambarus clarkii from the ammonia stress group (Shen et al., 2021), which implies that this gene has the potential to be served as the one of the bio-indicators of shrimp health status. As the previous study by Shen et al. (2021) mainly focused on the effects of ammonia stress on Procambarus clarkia for 24 h, thus the following health status of them with higher expression of Slc6a9 is unknown. In our study, the differential expression (upregulation) of this gene in the moribund shrimp compared to the normal shrimp demonstrated that this gene is involved in vitality regulation (stress response) which supports the previous studies, but keeping shrimp alive well based on upregulation of this gene still needs more efforts. Notably genetic variants in this gene have been wildly studied in human for health problems (Deng et al., 2008; Koller et al., 2010; Nuzziello et al., 2019), which leads to the direction of future study for shrimp.

As to P450 monooxygenase system (CYPs), previous studies had showed that the induction of CYPs can indicated the exposure of aquatic animals to toxic compounds (Stegeman and Lech, 1991; James and Boyle, 1998). The number of known P450 enzymes exceeds 1000, and more attentions had been paid on the properties of the most important P450 enzymes taking part in metabolism of xenobiotics in organisms (Anzenbacher and Anzenbacherová, 2001). Unlike the Slc6a9, upregulation of Cyp3a30 was in the normal shrimp compared to the moribund shrimp in this study, which indicated differential expression (downregulation) of this gene is adverse to health of shrimp. Recently, a study utilized the freshwater shrimp Caridina nilotica as indicators of persistent pollutant exposure, in which CYPs activity was significantly higher in shrimp at sites directly adjacent to regions of increased human activity, and the biomarkers of exposure (CYPs) was considered to be suitable to detect effects of stressors, probably persistent pollutants (Rensburg et al., 2020). Thus, CYPs will have the potential to regulate vitality of shrimp. As the members of CYPs, CYP3As are involved in metabolic clearance of numerous chemically diverse compounds, most studies of them have been performed in mammals and fishes (Hegelund and Celander, 2003; Uno et al., 2012). In the future, identification of specific loci on Cyp3a30 involved in vitality regulation for shrimp and further verifying its function will be the next important work to us as Religia et al. (2021) did, who disrupted CYP360A8 by coinjecting CYP360A8 targeting guide RNA and Cas9 proteins into Daphnia magna eggs, established one monoallelic CYP360A8 mutant line. This CYP360A8 mutant had a higher sensitivity to the herbicide paraquat compared to the wild type.

This study firstly used two tests of transcriptomic comparisons in two salinity environments to identify potential pathways and genes on F. chinensis, not only narrowed the search scope of target pathways and genes, but also could improve the accuracy of the results to some extent. Recently, there is little evidence for genes of Dhdh, Itgbl in crustaceans, and the function of these genes (including other target genes) in vitality regulation of shrimp needs further investigation by more direct methods in the future. In conclusion, differential expression of the five DEGs (Itgbl, Slc2a8, Dhdh, Cyp3a30, Slc6a9) revealed by this study could well support the previous studies. In addition, the five target DEGs in the key pathways and GO categories have the potential to regulate vitality of shrimp. The study identified potential pathways and genes involved in vitality regulation will be the foundation for further investigation of genetic diversity and breeding programs.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/sra/PRJNA734726.

Author contributions

JS, LZ, and ZW: data curation. JL and DZ: funding acquisition. JS and LZ: resources. JL and JS: writing—original draft. JL, JS, and DZ writing—review and editing. All authors contributed to the article and approved the submitted version.

Funding

This work was funded by National Natural Science Foundation of China (32070526); Natural Science Foundation of the Jiangsu Higher Education Institutions of China (19KJD180001); and sponsored by “Qing Lan Project of Jiangsu Province of China”; Young Talents Support Program in Lianyungang Normal College (LSZQNXM201702); Open Foundation of Jiangsu Key Laboratory for Bioresources of Saline Soils (JKLBS2016008).

Acknowledgments

We thank Dachuan Dong, Zhen Wang, Shiguang Shao, Xia Zheng, and Yunhua Xu for their assistance in our work. We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript. Reviewers provided constructive recommendations for improving our manuscript.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fevo.2022.716018/full#supplementary-material

References

  • 1

    AbdelrahmanH.ElHadyM.Alcivar-WarrenA.AllenS.Al-TobaseiR.BaoL.et al (2017). Aquaculture genomics, genetics and breeding in the United States: current status, challenges, and priorities for future research.BMC Genomics18:191. 10.1186/s12864-017-3557-1

  • 2

    AlavaV. R.PascualF. P. (1987). Carbohydrate requirements of Penaeus monodon (Fabricius) juveniles.Aquaculture61211217. 10.1016/0044-8486(87)90150-5

  • 3

    AltschulS. F.GishW.MillerW.MyersE. W.LipmanlD. J. (1990). Basic local alignment search tool.J. Mol. Biol.215403410. 10.1016/S0022-2836(05)80360-2

  • 4

    AnzenbacherP.AnzenbacherováE. (2001). Cytochromes P450 and metabolism of xenobiotics.Cell. Mol. Life Sci.58737747. 10.1007/PL00000897

  • 5

    CaoL.ChenY.DongS.HansonA.HuangB.LeadbitterD.et al (2017). Opportunity for marine fisheries reform in China.Proc. Natl. Acad. Sci. U.S.A.114435442. 10.1073/pnas.1616583114

  • 6

    ChenJ. C.LinJ. N. (1994). Osmolality and chloride concentration in the hemolymph of subadult Penaeus chinensis subjected to different salinity levels.Aquaculture125167174. 10.1016/0044-8486(94)90293-3

  • 7

    ChenJ. C.LinM. N.TingY. Y.LinJ. N. (1995). Survival, haemolymph osmolality and tissue water Penaeus chinensis juveniles acclimated to different salinity and temperature levels.Comp. Biochem. Physiol. A Physiol.110253258. 10.1016/0300-9629(94)00164-O

  • 8

    ChungJ. S.MaurerL.BratcherM.PitulaJ. S.OgburnM. B. (2012). Cloning of aquaporin-1 of the blue crab, Callinectes sapidus: its expression during the larval development in hyposalinity.Aquat. Biosyst.8:21. 10.1186/2046-9063-8-21

  • 9

    CockP. J. A.FieldsC. J.GotoN.HeuerM. L.RiceP. M. (2010). The sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants.Nucleic Acids Res.3817671771. 10.1093/nar/gkp1137

  • 10

    ConesaA.GotzS.Garcia-GomezJ. M.TerolJ.TalonM.Rob-lesM. (2005). Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.Bioinformatics2136743676. 10.1093/bioinformatics/bti610

  • 11

    DengH. B.ParekhH. K.ChowK. C.SimpkinsH. (2002). Increased expression of dihydrodiol dehydrogenase induces resistance to cisplatin in human ovarian carcinoma cells.J. Biol. Chem.2771503515043. 10.1074/jbc.M112028200

  • 12

    DengX.SagataN.TakeuchiN.TanakaM.NinomiyaH.IwataN.et al (2008). Association study of polymorphisms in the neutral amino acid transporter genes SLC1A4, SLC1A5 and the glycine transporter genes SLC6A5, SLC6A9 with schizophrenia.BMC Psychiatry8:58. 10.1186/1471-244X-8-58

  • 13

    DuY.ZhangY.ShiJ. (2019). Relationship between sea surface salinity and ocean circulation and climate change.Sci. China Earth Sci.62771782. 10.1007/s11430-018-9276-6

  • 14

    EissaN.WangH. P. (2014). Transcriptional stress responses to environmental and husbandry stressors in aquaculture species.Rev. Aquacult.6128. 10.1111/raq.12081

  • 15

    FlorkinM.SchoffenielsE. (1969). Molecular Approaches to Ecology.New York, NY: Academic Press, 203.

  • 16

    GaoH.LaiX.KongJ.WangW.MengX.YanB.et al (2014). Cloning of Hsp21 gene and its expression in Chinese shrimp Fenneropenaeus chinensis in response to WSSV challenge.J. Appl. Genet.55231238. 10.1007/s13353-013-0191-8

  • 17

    HaasB. J.PapanicolaouA.YassouR. M.GrabherrM.BloodP. D.BowdenetJ.et al (2013). De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis.Nat. Protoc.8, 14941512. 10.1038/nprot.2013.084

  • 18

    HeY.LiZ.ZhangH.HuS.WangQ.LiJ. (2019). Genome-wide identification of Chinese shrimp (Fenneropenaeus chinensis) microRNA responsive to low pH stress by deep sequencing.Cell Stress Chaperones24689695. 10.1007/s12192-019-00989-x

  • 19

    HegelundT.CelanderM. C. (2003). Hepatic versus extrahepatic expression of CYP3A30 and CYP3A56 in adult killifish (Fundulus heteroclitus).Aquat. Toxicol.64277291. 10.1016/S0166-445X(03)00057-2

  • 20

    HenryR. P. (2001). Environmentally mediated carbonic anhydrase induction in the gills of euryhaline crustaceans.J. Exp. Biol.2049911002.

  • 21

    HenryR. P.CameronJ. N. (1982). The distribution and partial characterization of carbonic anhydrase in selected aquatic and terrestrial decapod crustaceans.J. Exp. Zool.221309321. 10.1002/jez.1402210306

  • 22

    HenryR. P.LucuC.OnkenH.WeihrauchD. (2012). Multiple functions of the crustacean gill: osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals.Front. Physiol.3:431. 10.3389/fphys.2012.00431

  • 23

    HowardA.TahirI.JavedS.WaringS. M.FordD.HirstB. H. (2010). Glycine transporter GLYT1 is essential for glycine-mediated protection of human intestinal epithelial cells against oxidative damage.J. Physiol.588(Pt 6), 9951009. 10.1113/jphysiol.2009.186262

  • 24

    JamesM. O.BoyleS. M. (1998). Cytochromes P450 in crustacea.Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol.121157172. 10.1016/S0742-8413(98)10036-1

  • 25

    JeongS. J.StithamJ.EvansT. D.ZhangX.Rodriguez-VelezA.YehY. S.et al (2021). Trehalose causes low-grade lysosomal stress to activate TFEB and the autophagy-lysosome biogenesis response.Autophagy1737403752. 10.1080/15548627.2021.1896906

  • 26

    KoenigS.FernandezP.SoleM. (2012). Differences in cytochrome P450 enzyme activities between fish and crustacea: relationship with the bioaccumulation patterns of polychlorobiphenyls (PCBs).Aquat. Toxicol.1081117. 10.1016/j.aquatox.2011.10.016

  • 27

    KollerG.ZillP.FehrC.PogarellO.BondyB.SoykaM.et al (2010). No association of alcohol dependence with SLC6A5 and SLC6A9 glycine transporter polymorphisms.Addict. Biol.14506508. 10.1111/j.1369-1600.2009.00170.x

  • 28

    KongF. (2019). Variation diagnosis and regional comparison of different intensity of rainfalls and their contribution to total rainfall in China in the context of global warming.Asian Agric. Res.114455.

  • 29

    KozeraB.RapaczM. (2013). Reference genes in real-time PCR.J. Appl. Genet.54391406. 10.1007/s13353-013-0173-x

  • 30

    LalithaS. (2000). Primer premier 5.Biotech Softw. Internet Rep.1270272. 10.1089/152791600459894

  • 31

    LelongC.MathieuM.FavrelP. (2001). Identification of new bone morphogenetic protein-related members in invertebrates.Biochimie83423426. 10.1016/S0300-9084(01)01260-3

  • 32

    LeungP. T. Y.IpJ. C. H.MakS. S. T.QiuJ. W.LamP. K. S.WongC. K. C.et al (2014). De novo transcriptome analysis of Perna viridis highlights tissue-specific patterns for environmental studies.BMC Genomics15:804. 10.1186/1471-2164-15-804

  • 33

    LiB.DeweyC. N. (2011). RSEM: accurate transcript quantification from RNA-seq data with or without a reference genome.BMC Bioinformatics12:323. 10.1186/1471-2105-12-323

  • 34

    LiJ.LiW.ZhangX. (2019). Effects of dissolved oxygen, starvation, temperature, and salinity on the locomotive ability of juvenile Chinese shrimp Fenneropenaeus chinensis.Ethol. Ecol. Evol.31155172. 10.1080/03949370.2018.1526215

  • 35

    LiY.WangX.LiC.HuS.YuJ.SongS. (2014). Transcriptome-wide n6-methyladenosine profiling of rice callus and leaf reveals the presence of tissue-specific competitors involved in selective mRNA modification.RNA Biol.1111801188. 10.4161/rna.36281

  • 36

    LuY.QiuQ.LiC.ChengL.LiuJ. (2020). Antioxidant responses of Fenneropenaeus chinensis to white spot syndrome virus challenge.Aquacult. Int.28139151. 10.1007/s10499-019-00450-x

  • 37

    MartinM. (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads.EMBnet J.171012. 10.14806/ej.17.1.200

  • 38

    MengX.DongL.ShiX.LiX.SuiJ.LuoK.et al (2019). Screening of the candidate genes related to low-temperature tolerance of Fenneropenaeus chinensis based on high throughput transcriptome sequencing.PLoS One14:e0211182. 10.1371/journal.pone.0211182

  • 39

    NeufeldG. J.PritchardJ. B. (1979). Osmoregulation and gill Na, K-ATPase in the rock crab, Cancer irroratus: response to DDT.Comp. Biochem. Physiol. C Comp. Pharmacol.62c165172. 10.1016/0306-4492(79)90005-4

  • 40

    NuzzielloN.CraigF.SimoneM.ConsiglioA.LicciulliF.MargariL.et al (2019). Integrated analysis of microRNA and mRNA expression profiles: an attempt to disentangle the complex interaction network in attention deficit hyperactivity disorder.Brain Sci.9:288. 10.3390/brainsci9100288

  • 41

    PenningT. M. (1993). Dihydrodiol dehydrogenase and its role in polycyclic aromatic hydrocarbon metabolism.Chem. Biol. Interact.89134. 10.1016/0009-2797(93)03203-7

  • 42

    ReesM. I.HarveyK.PearceB. R.ChungS. K.DuguidI. C.ThomasP.et al (2006). Mutations in the gene encoding GlyT2 (SLC6A5) define a presynaptic component of human startle disease.Nat. Genet.38801806. 10.1038/ng1814

  • 43

    ReinerA.YekutieliD.BenjaminiY. (2003). Identifying differentially expressed genes using false discovery rate controlling procedures.Bioinformatics19368375. 10.1093/bioinformatics/btf877

  • 44

    ReligiaP.NguyenN. D.NongQ. D.MatsuuraT.KatoY.WatanabeH. (2021). Mutation of the cytochrome P450 CYP360A8 gene increases sensitivity to paraquat in Daphnia magna.Environ. Toxicol. Chem.4012791288. 10.1002/etc.4970

  • 45

    RensburgG. J.BervoetsL.SmitN. J.WepenerV. (2020). Biomarker responses in the freshwater shrimp Caridina nilotica as indicators of persistent pollutant exposure.Bull. Environ. Contam. Toxicol.104193199. 10.1007/s00128-019-02773-0

  • 46

    RewitzK. F.StyrishaveB.Løbner-OlesenA.AndersenO. (2006). Marine invertebrate cytochrome P450: emerging insights from vertebrate and insect analogies.Comp. Biochem. Physiol. C Toxicol. Pharmacol.143363381. 10.1016/j.cbpc.2006.04.001

  • 47

    SeoY.KingsleyS.WalkerG.MondouxM. A.TissenbaumH. A. (2018). Metabolic shift from glycogen to trehalose promotes lifespan and healthspan in Caenorhabditis elegans.Proc. Natl. Acad. Sci. U.S.A.115E2791E2800. 10.1073/pnas.1714178115

  • 48

    ShenC.TangD.BaiY.LuoY.WuL.ZhangY.et al (2021). Comparative transcriptome analysis of the gills of Procambarus clarkii provide novel insights into the response mechanism of ammonia stress tolerance.Mol. Biol. Rep.4826112618. 10.1007/s11033-021-06315-y

  • 49

    SnyderM. J. (2000). Cytochrome P450 enzymes in aquatic invertebrates: recent advances and future directions.Aquat. Toxicol.48529547. 10.1016/S0166-445X(00)00085-0

  • 50

    StegemanJ. J.LechJ. J. (1991). Cytochrome P-450 monooxygenase systems in aquatic species: carcinogen metabolism and biomarkers for carcinogen and pollutant exposure.Environ. Health Perspect.90101109. 10.2307/3430851

  • 51

    SunH.ZhangA.SongQ.FangH.LiuX.SuJ.et al (2018). Functional metabolomics discover pentose and glucuronate interconversion pathway as promising targets of Yanghuang syndrome treatment with Yinchenhao Tang.RSC Adv.83683136839. 10.1039/c8ra06553e

  • 52

    TollefsenK. E.SongY.HøgåsenT.ØverjordetI. B.AltinD.HansenB. H. (2017). Mortality and transcriptional effects of inorganic mercury in the marine copepod Calanus finmarchicus.J. Toxicol. Environ. Health A80845861. 10.1080/15287394.2017.1352198

  • 53

    TrapnellC.HendricksonD. G.SauvageauM.GoffL.RinnJ. L.PachterL. (2013). Differential analysis of gene regulation at transcript resolution with RNA-seq.Nat. Biotechnol.314653. 10.1038/nbt.2450

  • 54

    UnoT.IshizukaM.ItakuraT. (2012). Cytochrome P450 (CYP) in fish.Environ. Toxicol. Pharmacol.34113. 10.1016/j.etap.2012.02.004

  • 55

    VarleyD. G.GreenawayP. (1994). Nitrogenous excretion in the terrestrial carnivorous crab Geograpsus grayi: site and mechanism of excretion.J. Exp. Biol.190179193.

  • 56

    VinuesaA. G.Abdelilah-SeyfriedS.KnausP.ZwijsenA.BaillyS. (2015). BMP signaling in vascular biology and dysfunction.Cytokine Growth Factor Rev.276579. 10.1016/j.cytogfr.2015.12.005

  • 57

    WangS.WangY.WuH.HuL. (2013). Rbp2 induces epithelial-mesenchymal transition in non-small cell lung cancer.PLoS One8:e84735. 10.1371/journal.pone.0084735

  • 58

    WhitingD. G.TolleyH. D.FellinghamG. W. (2000). An empirical Bayes procedure for adaptive forecasting of shrimp yield.Aquaculture182215228. 10.1016/S0044-8486(99)00263-X

  • 59

    YaoD.SuH.ZhuJ.ZhaoX.AweyaJ. J.WangF.et al (2018). SNPs in the Toll1 receptor of Litopenaeus vannamei are associated with immune response.Fish Shellfish Immunol.72410417. 10.1016/j.fsi.2017.11.018

  • 60

    YaoZ. L.WangH.ChenL.ZhouK.YingC. Q.LaiQ. F. (2012). Transcriptomic profiles of Japanese medaka (Oryzias latipes) in response to alkalinity stress.Genet. Mol. Res.1122002246. 10.4238/2012.June.15.2

  • 61

    YeJ.WangZ.WangM.XuY.ZengT.YeD.et al (2018). Increased kielin/chordin-like protein levels are associated with the severity of heart failure.Clin. Chim. Acta486381386. 10.1016/j.cca.2018.08.033

  • 62

    YuY.ChenS.ChenM.TianL.NiuJ.LiuY.et al (2016). Effect of cadmium-polluted diet on growth, salinity stress, hepatotoxicity of juvenile Pacific white shrimp (Litopenaeus vannamei): protective effect of Zn(II)–curcumin.Ecotoxicol. Environ. Saf.125176183. 10.1016/j.ecoenv.2015.11.043

  • 63

    YuanJ.ZhangX.WangM.SunY.LiuC.LiS.et al (2021). Simple sequence repeats drive genome plasticity and promote adaptive evolution in penaeid shrimp.Commun. Biol.4:186. 10.1038/s42003-021-01716-y

Summary

Keywords

freshwater aquaculture, global warming, moribund, shrimp, vitality

Citation

Liu J, Zhang D, Zhang L, Wang Z and Shen J (2022) New Insight on Vitality Differences for the Penaeid Shrimp, Fenneropenaeus chinensis, in Low Salinity Environment Through Transcriptomics. Front. Ecol. Evol. 10:716018. doi: 10.3389/fevo.2022.716018

Received

28 May 2021

Accepted

14 February 2022

Published

28 March 2022

Volume

10 - 2022

Edited by

Lin Zhang, Hubei University of Chinese Medicine, China

Reviewed by

Yunji Xiu, Qingdao Agricultural University, China; Kai Lyu, Nanjing Normal University, China

Updates

Copyright

*Correspondence: Jun Liu, Jie Shen,

This article was submitted to Ecophysiology, a section of the journal Frontiers in Ecology and Evolution

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics