ORIGINAL RESEARCH article

Front. Endocrinol., 20 May 2022

Sec. Reproduction

Volume 13 - 2022 | https://doi.org/10.3389/fendo.2022.874987

Comprehensive Assessment of the STIMs and Orais Expression in Polycystic Ovary Syndrome

  • 1. Center for Reproductive Medicine, Cheeloo College of Medicine, Shandong University, Jinan, China

  • 2. Key laboratory of Reproductive Endocrinology of Ministry of Education, Shandong University, Jinan, China

  • 3. Shandong Key Laboratory of Reproductive Medicine, Jinan, China

  • 4. Shandong Provincial Clinical Research Center for Reproductive Health, Jinan, China

  • 5. National Research Center for Assisted Reproductive Technology and Reproductive Genetics, Shandong University, Jinan, China

  • 6. Department of Reproductive Medicine, Women and Children’s Hospital, School of Medicine, Xiamen University, Xiamen, China

  • 7. Xiamen Key Laboratory of Reproduction and Genetics, Xiamen, China

  • 8. Shandong Provincial Maternal and Child Health Care Hospital, Cheeloo College of Medicine, Shandong University, Jinan, China

  • 9. Guangdong Provincial People’s Hospital, Guangzhou, China

Abstract

Background:

Polycystic ovary syndrome (PCOS) is a heterogeneous endocrine disease characterized by irregular menstrual, hyperandrogenism, and polycystic ovaries. The definitive mechanism of the disorder is not fully elucidated. Store-operated Ca2+ entry (SOCE) plays a role in glucose and lipid metabolism, inflammation, hormone secretion, and cell proliferation. STIMs and Orais are the main elements of SOCE. The potential role of SOCE in PCOS pathogenesis remains unclear.

Methods:

The expression of STIMs and Orais in granulosa cells (GCs) derived from 83 patients with PCOS and 83 controls were analyzed, respectively, by using quantitative reverse transcription polymerase chain reaction. Binary regression analysis was used to identify the factors affecting PCOS after adjusted by body mass index and age. Pearson correlation analysis was used to determine the association between PCOS phenotypes and SOCE genes expression.

Results:

Significantly increased expression of STIM1, STIM2, Orai1, and Orai2 were observed in patients with PCOS compared with controls (P = 0.037, P = 0.004, P ≤ 0.001, and P = 0.013, respectively), whereas the expression of Orai3 was decreased (P = 0.003). In addition, the expression levels of STIMs and Orais were identified as the factors affecting PCOS (P < 0.05). The expressions of these genes were correlated with hormone level and antral follicle count (P < 0.05).

Conclusions:

For the first time, our findings indicated that the elements of SOCE were differently expressed, where STIM1, STIM2, Orai1, and Orai2 significantly increased, whereas Orai3 decreased in PCOS GCs, which might be dominantly involved in dysfunction of ovarian GCs and hormonal changes in PCOS.

Introduction

Polycystic ovary syndrome (PCOS) is a heterogeneous endocrine disease that affects approximately 4%–21% of reproductive age women worldwide (1). It could be diagnosed by irregular menstrual, hyperandrogenism, and polycystic ovarian morphology (1, 2). In addition to female infertility, a wide range of pathological symptoms, such as insulin resistance, obesity, diabetes mellitus type II (T2DM), and hypertension, are common in women with PCOS (2, 3). Literature suggests that genetic and environmental factors contribute to the syndrome in a complicated manner (4, 5). However, the definitive mechanism is not fully elucidated.

Calcium (Ca2+) takes essential part in various cellular functions, signaling pathways, and metabolic processes in all tissues as a second messenger (6). Maintaining calcium homeostasis is crucial in physiological activities, whereas dysregulation of Ca2+ signals has been associated with some of the major diseases in humans such as cardiac disease, Alzheimer’s disease, pancreatitis, and asthma (7–10).

Store-operated Ca2+ entry (SOCE) is a fundamentally important mechanism for maintaining calcium homeostasis, which composes of endoplasmic reticulum (ER) Ca2+-binding protein stromal interaction molecules (STIMs) and Ca2+ release–activated Ca2+ channel proteins (ORAIs). STIM1 and Orai1 are the main elements of SOCE. Once the ER Ca2+ store depletion, STIM1 is activated to couple to open Orai1 channel to refill ER-luminal Ca2+ storage and then regulate the subsequent cellular physiological processes (11–14). In addition, recent studies have reported that dysfunctional SOCE in β-cell contributes to diabetes pathogenesis (15) and defined SOCE as a critical Ca2+ signaling pathway that controls lipid metabolism in mouse and human cells (16), as well as in immunity (17) and inflammation (18) processes. Women with PCOS have an increased risk of chronic diseases such as T2DM and obesity (2). It is reasonable to hypothesize whether abnormal SOCE will have a long-term effect on PCOS. Moreover, dysfunction of ovarian granulosa cells (GCs) was estimated as an important element of the arrest of follicle growth, which was demonstrated to be the underlying mechanism of etiology of PCOS (19, 20). Few studies have been conducted to determine the association between SOCE and PCOS, and it is assumed that the main elements of SOCE show differential expression in PCOS, which may then transmit aberrant regulatory signaling in cellular processes and result in the functional abnormality of GCs. Therefore, in this study, we aimed to investigate the trends of core factors of the SOCE signaling pathway differentially expressed in GCs between the patients with PCOS and controls to partly explain the pathophysiology of the disease.

Material and Methods

Patients and Granulosa Cell Collection

We collected GCs from follicular fluid of 166 included participants (83 patients with PCOS and 83 controls) undergoing oocyte retrieval for in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI) between 2019 and 2021 at the Center for Reproductive Medicine, Shandong University. Women with PCOS were diagnosed according to the revised Rotterdam consensus (21). Any two of the following three criteria were required: (1) oligo- and/or anovulation; (2) clinical and/or biochemical signs of hyperandrogenism; and (3) polycystic ovaries, etiologies such as Cushing syndrome, delayed adrenocortical hyperplasia, and adrenal androgen-secreting tumors were excluded. Women with regular menstruation, no endocrine abnormalities and normal ovarian morphology were included as controls. The patients were all aged 20 to 40 years, and we controlled their body mass index (BMI) under 30 kg/m2. Moreover, we excluded patients with ovarian surgery history, reproductive system abnormalities, chromosomal diseases, and metabolic disorders that might affect pregnancy outcomes. This study was approved by the institutional review board of the Center for Reproductive Medicine, Cheeloo College of Medicine, Shandong University with approval number 132. The clinical and endocrine parameters of PCOS and control groups were analyzed. GCs from follicular fluid of patients were collected as described previously (22) and then immediately stored at −80°C for further analysis.

Clinical Phenotype Measurement and Ultrasonography

Endocrine hormones including anti-Mullerian hormone (AMH), follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), and total testosterone (T) detected using venous blood on days 2–4 of the menstrual cycle were retrospectively analyzed. Moreover, after 12 h of overnight fasting, venous blood was collected to measure fasting insulin (FINS) and plasma glucose (GLU). The homeostasis model assessment of insulin resistance (HOMA-IR) was calculated by the following equation: HOMA-IR = GLU (mmol/L) × FINS (mIU/L)/22.5. Transvaginal ultrasonography was routinely conducted. The antral follicle count (AFC) was defined as the number of bilateral follicles (2–10 mm in diameter) in the early follicular phase.

Total RNA Extraction and Real-Time PCR

To extract total RNA from GCs, TRIzol Reagent (Life Technologies, Shanghai) was used following the manufacturer’s instructions. Briefly, chloroform was added to TRIzol (1:5) for lysis, then incubated at room temperature for 2–3 min, and centrifuged at 12,000 × g at 4°C for 15 min, and the upper aqueous phase containing the RNA was processed by precipitation and elution to obtain pure RNA. Analyzing the quality of RNA by a NanoDrop 2000 (Thermo Fisher Scientific, USA) at the absorbance of 260 nm/280 nm. According to the manufacturer’s protocol, RNA (1 μg) was used to synthesize the corresponding cDNA using the Prime Script RT Reagent Kit with gDNA Eraser (TaKaRa, China). Then, cDNA amplification was performed by reverse transcription polymerase chain reaction (RT-PCR) in replicate using Quanti Nova SYBR Green PCR Kit (QIAGEN, Germany) following the manufacturer’s instructions. Because the amount of RNA that we obtained were not enough to verify in multiple target genes at the same time, we randomly enrolled 100 participants in each group as much as possible for subsequent RT-PCR experiment of the five genes, and the verification cohort was 50 versus 50. The PCR primers for RT-PCR were all listed in Table 1. mRNA levels were normalized against the corresponding levels of glyceraldehyde-3-phosphate Dehydrogenase (GAPDH) mRNA, which served as a housekeeping gene. The relative expression of genes was calculated using the 2–ΔΔCT method and expressed as a fold change relative to that of the controls.

Table 1

GenePrimer Sequences
STIM1F : AGTCACAGTGAGAAGGCGAC
R: CAATTCGGCAAAACTCTGCTG
Orai1F : GGACGCTGACCACGACTAC
R : GGGACTCCTTGACCGAGTT
STIM2F : GGAGAGGCTTGAAAAGGCAC
R : CCTTAGCTCTCTCAGCCGAC
Orai2F : CATCCACTTCTACCGCTCCC
R : CAGCTGGACCTTGAGCTTGT
Orai3F : CCTGGTTGGTTGGGTCAAGT
R : CAGAGGACCGTGGGAGATTG
GAPDHF: GCACCGTCAAGGCTGAGAAC
R: TGGTGAAGACGCCAGTGGA

Sequences of primers for RT-PCR.

STIM1, stromal interaction molecule 1; STIM2, stromal interaction molecule 2; Orai1, calcium release-activated calcium modulator1; Orai2, calcium release-activated calcium modulator 2; Orai3, calcium release-activated calcium modulator 3.

Statistical Analysis

Statistical analysis was performed using SPSS 21.0 (SPSS, Chicago, IL, USA). Kolmogorov–Smirnov test was used to test for normality of continuous variables. The student’s t-test was used to analyze normally distributed variables to determine statistical significance, and Mann-Whitney U-test was used to assess non-parametric data. Binary logistic regression analysis was use to assess the risk factors of PCOS. Correlation between different variables was analyzed by Pearson correlation analysis. Value of P < 0.05 was considered statistically significant.

Results

Clinical Characteristics of Patiens with PCOS and Controls

The clinical characteristics of the 83 patients with PCOS and 83 controls were shown in Table 2. Data were presented as mean ± SD. Compared to controls, BMI (P < 0.001), AMH (P < 0.001), LH (P < 0.001), T (P < 0.001), and AFC (P < 0.001) were significantly increased in PCOS group while FSH (P=0.003) was significantly decreased. In addition, the corresponding clinical baseline characteristics of each gene group (50 patients with PCOS versus 50 controls) were shown in Supplementary Table 1.

Table 2

Basic parametersPCOS (n = 83)Control (n = 83)P-value
Age (years)30.1 ± 430.56 ± 4.35NS
BMI (kg/m2) 24.84 ± 3.4422.84 ± 3.45<0.001
AMH (ng/ml)8.08 ± 4.113.99 ± 1.85<0.001
LH (IU/L)8.92 ± 4.326.18 ± 7.19<0.001
FSH (U/L)5.71 ± 1.606.18 ± 1.610.003
T (ng/dL)36.27 ± 13.4825.05 ± 11.25<0.001
E2 (pg/mL)39.68 ± 18.6840.02 ± 18.08NS
GLU (mmol/L)5.31 ± 0.405.24 ± 0.38NS
Fasting Insulin (mIU/L)16.37 ± 7.3515.6 ± 13.56NS
HOMA-IR3.92 ± 1.823.63 ± 3.24NS
AFC24.76 ± 7.9216.15 ± 5.85<0.001

Clinical and endocrine parameters of patients with PCOS and controls.

Data were presented as mean ± SD. BMI, body mass index; AMH, antimullerian hormone; LH, luteinizing hormone; FSH, follicle-stimulating hormone; E2, estradiol; T, testosterone; GLU, glucose; AFC, antral follicle count. NS, not statistically significant.

The Expression of STIMs and Orais in PCOS GCs

To verify the activation of SOCE signaling, expression levels of core components in the SOCE signaling pathway were examined by RT-PCR between 50 patients with PCOS and 50 control patients, respectively. Using GAPDH as a housekeeping gene. As shown in Figure 1, the expression of STIM1, STIM2, Orai1, and Orai2 were significantly increased in PCOS group (P = 0.037, P = 0.004, P ≤ 0.001, and P = 0.013, respectively), and Orai3 was significantly decreased in GCs of patients with PCOS (P=0.003).

Figure 1

Binary Logistic Regression Analysis of Gene Expression in PCOS

To eliminate the influences of age and BMI on the expression of genes, we used binary logistic regression model for analysis. The binary logistic regression analysis results of SOCE gene mRNA expression after adjusted using age and BMI were summarized in Table 3 and Figure 2. Logistic regression showed STIM1 (adjusted OR: 2.253, 95% CI: 1.151–4.414, P = 0.018), STIM2 (adjusted OR: 2.165, 95% CI: 1.091–4.298, P = 0.027), Orai1 (adjusted OR: 8.399, 95% CI: 2.398–29.421, P = 0.001), Orai2 (adjusted OR: 2.129, 95% CI: 1.118–4.055, P = 0.021), and Orai3 (adjusted OR: 0.245, 95% CI: 0.079–0.755, P = 0.014) were factors contributing to the incidence of PCOS.

Table 3

VariablesBSEWaldPAdjusted OR95% CI
LowerUpper
STIM1 expression0.8130.3435.6160.0182.2541.1514.414
STIM2 expression0.7720.354.8750.0272.1651.0914.298
Orai1 expression2.1280.6411.070.0018.3992.39829.421
Orai2 expression0.7560.3295.2860.0212.1291.1184.055
Orai3 expression−1.4090.5755.9960.0140.2450.0790.755

Logistic regression analysis of gene expression after adjusting for age and BMI.

Figure 2

Correlation Analysis Between Gene Expression Level and Baseline Data of Clinical Samples

To determine whether the expression level of genes is related to clinical endocrine and glucose metabolism characters of corresponding samples, we performed Pearson correlation analysis to elucidate the relationship between SOCE and various PCOS phenotypes by investigating the correlation between each differentially expressed mRNA levels of SOCE molecules and phenotype. As shown in Figure 3, STIMs and Orais mRNA levels showed significant correlation with LH and AFC, and STIM2 and Orai1 mRNA levels showed positive correlation with T, glucose, fasting insulin, and HOMA-IR. Futhermore, Orai1 and Orai2 mRNA levels in the GCs of patients with PCOS were positively correlated with AMH. In addition, The Orai3 exhibited a negative correlation with AMH while positively correlated with E2. In addition, we presented the exact correlation analysis data of all the measured indicators in Supplementary Table 2.

Figure 3

Discussion

Little is known regarding the functional role of SOCE in the pathology of PCOS; here, we analyzed the expression of several core genes of SOCE in GCs of PCOS patients for the first time. Our finding indicated that the SOCE signaling was determined in PCOS GCs, where STIM1, STIM2, Orai1, and Orai2 significantly increased, whereas Orai3 decreased. Moreover, STIMs and Orais were defined as the main factors affecting PCOS after adjusted by age and BMI. The expression levels of the five genes were mainly correlated with the hormone levels and AFC.

Calcium signaling is essential to regulate cellular activities including hormone secretion, proliferation, or apoptosis (6). It is important to maintain intracellular Ca2+ homeostasis, for abnormal Ca2+ fluctuations could induce rare and common disorders (14). SOCE is a sophisticated mechanism playing an important role in rescuing intracellular calcium oscillation (12, 13). In terms of cellular Ca2+ homeostasis, the ER plays a prime role in the process that ensuring proper protein folding which usually happened under ER stress (23, 24). It seems that SOCE could establish a certain connection with ER stress in PCOS.

In our present study, we hypothesized that the possible mechanisms for linking SOCE to pathogenesis of PCOS could be its protective effect on adapting ER stress and its ability on enhancing the proliferation signal of GCs. Under ER stress, STIMs activate and couple to Orai1 to rescue Ca2+ oscillation in ER, and then SOCE channel opens. In present study, we found that STIMs, Orai1 and Orai2 were upregulated in GCs of PCOS, so it could be speculated that SOCE signaling was activated in the pathogenesis PCOS. Takahashi et al. (25) demonstrated that ER stress was activated in GCs of both patients with PCOS and the dehydroepiandrosterone (DHEA)-treated mouse model of PCOS. Unanimously, in the study of Azhary and colleagues (26), they proved that androgens activate ER stress, thereby enhancing the apoptosis of GCs and resulting in the occurrence of PCOS. However, the sample amounts in this study were too small to support that the apoptosis of GCs was the cause of PCOS. Only the prolonged ER stress is accounted for apoptosis of cells (27). Investigators showed that ER stress activated an adaptive program termed unfolded protein response to deal with the accumulated misfolded proteins and thus relieved ER dysfunction (28, 29). Thus, we assumed that in the pathology of PCOS, ER Ca2+ was consumed in the state of ER stress accompanied by oscillation of cytosolic free Ca2+, and the SOCE was activated as an adaptive program in cells with the upregulated expression of STIM1, Orai1, STIM2, and Orai2. Moreover, elevated STIM1 and Orai1 expressions were thought to promote tumor cell proliferation in various cancers (30). Studies have proved that GCs proliferation was increased in the pathogenesis of PCOS (19). Taken together, the adaptive response of SOCE to ER stress in GCs may thereby lead to increased cell proliferation. In addition, the binary logistic regression analysis demonstrated STIMs and Orais were factors affecting PCOS after adjusted by BMI and age. The precise functional mechanism of SOCE in the onset and progression of PCOS remains to be explored.

Insulin resistance and compensatory hyperinsulinemia are often regarded as the main defects in women with PCOS (31). Hyperinsulinemia may further promote abnormal androgen secretion (32, 33). Moreover, it is demonstrated that SOCE has could be triggered at the stage of ER stress to increase the secretion of insulin even under sub-threshold glucose (34). Interestingly, insulin could conversely upregulate Orais (35). These studies linked insulin with SOCE. Thus, we analyzed the correlation between the expression levels of SOCE genes and glucose metabolism level as well as testosterone, and we found that expression level of Orai1 showed significant correlation with GLU, fasting insulin, and HOMA-IR. Moreover, STIM2 and Orai1 showed significant correlation with testosterone, respectively. However, the precise mechanisms still need to be fully described. SOCE through ORAI channels triggered by STIM1 is a major mechanism, mediating the signals of many hormones, growth factors, and neurotransmitters (36, 37). Tal et al. (38) found that the concentration of placental growth factor (PlGF) protein in follicular fluid from PCOS women was higher compared with controls and showed a positive correlation with AMH. Researchers also observed that PlGF could promote proliferation in ovary carcinoma cells by upregulating SOCE signal (39). Interestingly, hypothalamic luteinizing hormone-releasing hormone (LHRH) controls reproductive axis by promoting gonadotropin release, and researchers found that LHRH could activate Orai1 channels in mouse gonadotroph (40). The present study revealed that several SOCE elements showed correlation with AMH and LH, which are common characters of PCOS.

Many research studies recently indicated SOCE as a reliable therapeutic target and SOCE blocker might be of therapeutic benefit that the application of specific SOCE blockers would not affect other normal cells. Blocking SOCE could alleviate inflammation (41, 42), Zhang et al. (43) found that knocking down STIM1 in neutrophils could produce the same effect, which was due to reducing the production of reactive oxygen species (ROS). Furthermore, investigators suggested that inhibition of SOCE could block the proliferation of megakaryocytes in patients with myeloproliferative tumors (44). Clinical studies found increased glycolysis in women with PCOS (45). A new research showed that STIM1 promotes glycolysis and FAS during cell proliferation, and STIM1 was considered to be a new metabolic checkpoint (46). These results suggested that SOCE might be a possible target for the treatment and examination of PCOS. In short, there have been successful applications of SOCE blockers in clinical trials (47), but more research studies are needed to improve the treatment strategy.

The present study was the first to prove the several mRNA expressions level of SOCE elements of GCs in women with PCOS and to show significant relationship between these genes and PCOS characters. In addition, the expression levels of the STIMs and Orais were performed as major factors affecting PCOS after adjusted by age and BMI. Thus, we speculated SOCE could regulate cellular Ca2+ concentration and then took part in proliferation, and hormone secretion of GCs. Combining our findings with more detailed mechanistic and pharmacological PCOS studies may disclose additional valuable information and perhaps novel treatment strategies. However, several limitations still exist. First, GCs obtained before LH/hCG stimulation would be more appropriate in our study. However, it is very difficult to collect abundant immature GCs at gynecologic surgery. Second, the sample amount of the present study was relatively small. The results still need to be verified in a larger population.

Conclusion

In summary, for the first time, our findings indicated that SOCE was differently expressed, where STIM1, STIM2, Orai1, and Orai2 significantly increased, whereas Orai3 decreased in PCOS GCs, which might be dominantly involved in dysfunction of ovarian GCs and hormone changes in PCOS. However, further studies are required to investigate function and regulation of SOCE in PCOS.

Funding

National Key Research and Development Program of China (2021YFC2700404) and National Key R&D Program of China (2018YFC1003202).

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Ethics statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of Reproductive Medicine of Shandong University with approval number 132, on December 19, 2019.

Author contributions

YS conceived and designed this study. TS contributed to experiments, statistical analysis, interpretation of data, and draft of the manuscript. PL and QW performed statistical analysis and participated in the discussion. BH and YW acquired the data. YB analyzed and interpreted the data. YS participated in the discussion and critically revised the manuscript. All authors contributed to the article and approved the submitted version.

Acknowledgments

The authors thank all the patients who participated in the study.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fendo.2022.874987/full#supplementary-material

References

  • 1

    LiznevaDSuturinaLWalkerWBraktaSGavrilova-JordanLAzzizR. Criteria, Prevalence, and Phenotypes of Polycystic Ovary Syndrome. Fertil Steril (2016) 106(1):6–15. doi: 10.1016/j.fertnstert.2016.05.003

  • 2

    Escobar-MorrealeHF. Polycystic Ovary Syndrome: Definition, Aetiology, Diagnosis and Treatment. Nat Rev Endocrinol (2018) 14(5):270–84. doi: 10.1038/nrendo.2018.24

  • 3

    JohamAEPalombaSHartR. Polycystic Ovary Syndrome, Obesity, and Pregnancy. Semin Reprod Med (2016) 34(2):93–101. doi: 10.1055/s-0035-1571195

  • 4

    McAllisterJMLegroRSModiBPStraussJF3rd. Functional Genomics of PCOS: From GWAS to Molecular Mechanisms. Trends Endocrinol Metab (2015) 26(3):118–24. doi: 10.1016/j.tem.2014.12.004

  • 5

    RutkowskaAZDiamanti-KandarakisE. Polycystic Ovary Syndrome and Environmental Toxins. Fertil Steril (2016) 106(4):948–58. doi: 10.1016/j.fertnstert.2016.08.031

  • 6

    BerridgeMJ. The Inositol Trisphosphate/Calcium Signaling Pathway in Health and Disease. Physiol Rev (2016) 96(4):1261–96. doi: 10.1152/physrev.00006.2016

  • 7

    LlinasRMorenoH. Calcium Hypothesis of Alzheimer's Disease and Brain Aging: A Framework for Integrating New Evidence Into a Comprehensive Theory of Pathogenesis. Alzheimers Dement (2017) 13(2):178–82.e17. doi: 10.1016/j.jalz.2017.01.004

  • 8

    ZuoSKongDWangCLiuJWangYWanQet al. CRTH2 Promotes Endoplasmic Reticulum Stress-Induced Cardiomyocyte Apoptosis Through M-Calpain. EMBO Mol Med (2018) 10(3):e8237. doi: 10.15252/emmm.201708237

  • 9

    LeePJPapachristouGI. New Insights Into Acute Pancreatitis. Nat Rev Gastroenterol Hepatol (2019) 16(8):479–96. doi: 10.1038/s41575-019-0158-2

  • 10

    WangPZhaoWSunJTaoTChenXZhengYYet al. Inflammatory Mediators Mediate Airway Smooth Muscle Contraction Through a G Protein-Coupled Receptor-Transmembrane Protein 16A-Voltage-Dependent Ca(2+) Channel Axis and Contribute to Bronchial Hyperresponsiveness in Asthma. J Allergy Clin Immunol (2018) 141(4):1259–68.e11. doi: 10.1016/j.jaci.2017.05.053

  • 11

    van VlietARGiordanoFGerloSSeguraIVan EygenSMolenberghsGet al. The ER Stress Sensor PERK Coordinates ER-Plasma Membrane Contact Site Formation Through Interaction With Filamin-A and F-Actin Remodeling. Mol Cell (2017) 65(5):885–99.e6. doi: 10.1016/j.molcel.2017.01.020

  • 12

    SoboloffJRothbergBSMadeshMGillDL. STIM Proteins: Dynamic Calcium Signal Transducers. Nat Rev Mol Cell Biol (2012) 13(9):549–65. doi: 10.1038/nrm3414

  • 13

    NelsonHALeechCAKoppRFRoeMW. Interplay Between ER Ca(2+) Binding Proteins, STIM1 and STIM2, Is Required for Store-Operated Ca(2+) Entry. Int J Mol Sci (2018) 19(5):1522. doi: 10.3390/ijms19051522

  • 14

    Berna-ErroAWoodardGERosadoJA. Orais and STIMs: Physiological Mechanisms and Disease. J Cell Mol Med (2012) 16(3):407–24. doi: 10.1111/j.1582-4934.2011.01395.x

  • 15

    KonoTTongXTalebSBoneRNIidaHLeeCCet al. Impaired Store-Operated Calcium Entry and STIM1 Loss Lead to Reduced Insulin Secretion and Increased Endoplasmic Reticulum Stress in the Diabetic β-Cell. Diabetes (2018) 67(11):2293–304. doi: 10.2337/db17-1351

  • 16

    MausMCukMPatelBLianJOuimetMKaufmannUet al. Store-Operated Ca(2+) Entry Controls Induction of Lipolysis and the Transcriptional Reprogramming to Lipid Metabolism. Cell Metab (2017) 25(3):698–712. doi: 10.1016/j.cmet.2016.12.021

  • 17

    VaethMEcksteinMShawPJKozhayaLYangJBerberich-SiebeltFet al. Store-Operated Ca(2+) Entry in Follicular T Cells Controls Humoral Immune Responses and Autoimmunity. Immunity (2016) 44(6):1350–64. doi: 10.1016/j.immuni.2016.04.013

  • 18

    KaufmannUKahlfussSYangJIvanovaEKoralovSBFeskeS. Calcium Signaling Controls Pathogenic Th17 Cell-Mediated Inflammation by Regulating Mitochondrial Function. Cell Metab (2019) 29(5):1104–18.e6. doi: 10.1016/j.cmet.2019.01.019

  • 19

    LiMZhaoHZhaoSGWeiDMZhaoYRHuangTet al. The HMGA2-IMP2 Pathway Promotes Granulosa Cell Proliferation in Polycystic Ovary Syndrome. J Clin Endocrinol Metab (2019) 104(4):1049–59. doi: 10.1210/jc.2018-00544

  • 20

    HeTSunYZhangYZhaoSZhengYHaoGet al. MicroRNA-200b and microRNA-200c Are Up-Regulated in PCOS Granulosa Cell and Inhibit KGN Cell Proliferation via Targeting PTEN. Reprod Biol Endocrinol (2019) 17(1):68. doi: 10.1186/s12958-019-0505-8

  • 21

    Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group. Revised 2003 Consensus on Diagnostic Criteria and Long-Term Health Risks Related to Polycystic Ovary Syndrome (PCOS). Hum Reprod (2004) 19(1):41–7. doi: 10.1016/j.fertnstert.2003.10.004

  • 22

    AzharyJMKHaradaMKunitomiCKusamotoATakahashiNNoseEet al. Androgens Increase Accumulation of Advanced Glycation End Products in Granulosa Cells by Activating ER Stress in PCOS. Endocrinology (2020) 161(2):bqaa015. doi: 10.1210/endocr/bqaa015

  • 23

    McClellanAJTamSKaganovichDFrydmanJ. Protein Quality Control: Chaperones Culling Corrupt Conformations. Nat Cell Biol (2005) 7(8):736–41. doi: 10.1038/ncb0805-736

  • 24

    HartlFUBracherAHayer-HartlM. Molecular Chaperones in Protein Folding and Proteostasis. Nature (2011) 475(7356):324–32. doi: 10.1038/nature10317

  • 25

    TakahashiNHaradaMHirotaYNoseEAzharyJMKoikeHet al. Activation of Endoplasmic Reticulum Stress in Granulosa Cells From Patients With Polycystic Ovary Syndrome Contributes to Ovarian Fibrosis. Sci Rep (2017) 7(1):10824. doi: 10.1038/s41598-017-11252-7

  • 26

    AzharyJMKHaradaMTakahashiNNoseEKunitomiCKoikeHet al. Endoplasmic Reticulum Stress Activated by Androgen Enhances Apoptosis of Granulosa Cells via Induction of Death Receptor 5 in PCOS. Endocrinology (2019) 160(1):119–32. doi: 10.1210/en.2018-00675

  • 27

    SanoRReedJC. ER Stress-Induced Cell Death Mechanisms. Biochim Biophys Acta (2013) 1833(12):3460–70. doi: 10.1016/j.bbamcr.2013.06.028

  • 28

    NakkaVPGusainARaghubirR. Endoplasmic Reticulum Stress Plays Critical Role in Brain Damage After Cerebral Ischemia/Reperfusion in Rats. Neurotox Res (2010) 17(2):189–202. doi: 10.1007/s12640-009-9110-5

  • 29

    RissanenASiveniusJJolkkonenJ. Prolonged Bihemispheric Alterations in Unfolded Protein Response Related Gene Expression After Experimental Stroke. Brain Res (2006) 1087(1):60–6. doi: 10.1016/j.brainres.2006.02.095

  • 30

    XiaJWangHHuangHSunLDongSHuangNet al. Elevated Orai1 and STIM1 Expressions Upregulate MACC1 Expression to Promote Tumor Cell Proliferation, Metabolism, Migration, and Invasion in Human Gastric Cancer. Cancer Lett (2016) 381(1):31–40. doi: 10.1016/j.canlet.2016.07.014

  • 31

    Diamanti-KandarakisEDunaifA. Insulin Resistance and the Polycystic Ovary Syndrome Revisited: An Update on Mechanisms and Implications. Endocr Rev (2012) 33(6):981–1030. doi: 10.1210/er.2011-1034

  • 32

    NestlerJEJakubowiczDJde VargasAFBrikCQuinteroNMedinaF. Insulin Stimulates Testosterone Biosynthesis by Human Thecal Cells From Women With Polycystic Ovary Syndrome by Activating Its Own Receptor and Using Inositolglycan Mediators as the Signal Transduction System. J Clin Endocrinol Metab (1998) 83(6):2001–5. doi: 10.1210/jcem.83.6.4886

  • 33

    AzzizR. Androgen Excess is the Key Element in Polycystic Ovary Syndrome. Fertil Steril (2003) 80(2):252–4. doi: 10.1016/S0015-0282(03)00735-0

  • 34

    ZhangIXRenJVadrevuSRaghavanMSatinLS. ER Stress Increases Store-Operated Ca(2+) Entry (SOCE) and Augments Basal Insulin Secretion in Pancreatic Beta Cells. J Biol Chem (2020) 295(17):5685–700. doi: 10.1074/jbc.RA120.012721

  • 35

    ZengBChenGLGarcia-VazEBhandariSDaskoulidouNBerglundLMet al. ORAI Channels Are Critical for Receptor-Mediated Endocytosis of Albumin. Nat Commun (2017) 8(1):1920. doi: 10.1038/s41467-017-02094-y

  • 36

    LuikRMWangBPrakriyaMWuMMLewisRS. Oligomerization of STIM1 Couples ER Calcium Depletion to CRAC Channel Activation. Nature (2008) 454(7203):538–42. doi: 10.1038/nature07065

  • 37

    LiouJKimMLHeoWDJonesJTMyersJWFerrellJEJr.et al. STIM Is a Ca2+ Sensor Essential for Ca2+-Store-Depletion-Triggered Ca2+ Influx. Curr Biol (2005) 15(13):1235–41. doi: 10.1016/j.cub.2005.05.055

  • 38

    TalRSeiferDBGraziRVMalterHE. Follicular Fluid Placental Growth Factor Is Increased in Polycystic Ovarian Syndrome: Correlation With Ovarian Stimulation. Reprod Biol Endocrinol (2014) 12:82. doi: 10.1186/1477-7827-12-82

  • 39

    AbdelazeemKNMDroppovaBSukkarBAl-MaghoutTPelzlLZacharopoulouNet al. Upregulation of Orai1 and STIM1 Expression as Well as Store-Operated Ca(2+) Entry in Ovary Carcinoma Cells by Placental Growth Factor. Biochem Biophys Res Commun (2019) 512(3):467–72. doi: 10.1016/j.bbrc.2019.03.025

  • 40

    NúñezLBirdGSHernando-PérezEPérez-RiesgoEPutneyJWJr.VillalobosC. Store-Operated Ca(2+) Entry and Ca(2+) Responses to Hypothalamic Releasing Hormones in Anterior Pituitary Cells From Orai1-/- and heptaTRPC Knockout Mice. Biochim Biophys Acta Mol Cell Res (2019) 1866(7):1124–36. doi: 10.1016/j.bbamcr.2018.11.006

  • 41

    GandhirajanRKMengSChandramoorthyHCMallilankaramanKMancarellaSGaoHet al. Blockade of NOX2 and STIM1 Signaling Limits Lipopolysaccharide-Induced Vascular Inflammation. J Clin Invest (2013) 123(2):887–902. doi: 10.1172/JCI65647

  • 42

    WaldronRTChenYPhamHGoASuHYHuCet al. The Orai Ca(2+) Channel Inhibitor CM4620 Targets Both Parenchymal and Immune Cells to Reduce Inflammation in Experimental Acute Pancreatitis. J Physiol (2019) 597(12):3085–105. doi: 10.1113/JP277856

  • 43

    ZhangHClemensRALiuFHuYBabaYTheodorePet al. STIM1 Calcium Sensor Is Required for Activation of the Phagocyte Oxidase During Inflammation and Host Defense. Blood (2014) 123(14):2238–49. doi: 10.1182/blood-2012-08-450403

  • 44

    Di BuduoCAAbbonanteVMartyCMocciaFRumiEPietraDet al. Defective Interaction of Mutant Calreticulin and SOCE in Megakaryocytes From Patients With Myeloproliferative Neoplasms. Blood (2020) 135(2):133–44. doi: 10.1182/blood.2019001103

  • 45

    ZhaoYFuLLiRWangLNYangYLiuNNet al. Metabolic Profiles Characterizing Different Phenotypes of Polycystic Ovary Syndrome: Plasma Metabolomics Analysis. BMC Med (2012) 10:153. doi: 10.1186/1741-7015-10-153

  • 46

    ZhaoHYanGZhengLZhouYShengHWuLet al. STIM1 is a Metabolic Checkpoint Regulating the Invasion and Metastasis of Hepatocellular Carcinoma. Theranostics (2020) 10(14):6483–99. doi: 10.7150/thno.44025

  • 47

    BakowskiDMurrayFParekhAB. Store-Operated Ca(2+) Channels: Mechanism, Function, Pharmacology, and Therapeutic Targets. Annu Rev Pharmacol Toxicol (2021) 61:629–54. doi: 10.1146/annurev-pharmtox-031620-105135

Summary

Keywords

polycystic ovary syndrome, store-operated Ca2+ entry, STIM1, Orai1, STIM2

Citation

Song T, Li P, Wang Q, Hao B, Wang Y, Bian Y and Shi Y (2022) Comprehensive Assessment of the STIMs and Orais Expression in Polycystic Ovary Syndrome. Front. Endocrinol. 13:874987. doi: 10.3389/fendo.2022.874987

Received

13 February 2022

Accepted

28 March 2022

Published

20 May 2022

Volume

13 - 2022

Edited by

Rong Li, Peking University Third Hospital, China

Reviewed by

Mark Andrew Lawson, University of California, San Diego, United States; Yang Yu, Peking University Third Hospital, China

Updates

Copyright

*Correspondence: Yuhua Shi,

†These authors share first authorship

This article was submitted to Reproduction, a section of the journal Frontiers in Endocrinology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics