ORIGINAL RESEARCH article

Front. Cell. Infect. Microbiol., 11 January 2024

Sec. Molecular Bacterial Pathogenesis

Volume 13 - 2023 | https://doi.org/10.3389/fcimb.2023.1336600

Lysosomal trafficking regulator restricts intracellular growth of Coxiella burnetii by inhibiting the expansion of Coxiella-containing vacuole and upregulating nos2 expression

  • 1. College of Life Sciences, Southwest Forestry University, Kunming, China

  • 2. State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing, China

Abstract

Coxiella burnetii is an obligate intracellular bacterium that causes Q fever, a zoonotic disease typically manifests as a severe flu-illness. After invading into the host cells, C. burnetii delivers effectors to regulate the vesicle trafficking and fusion events to form a large and mature Coxiella-containing vacuole (CCV), providing sufficient space and nutrition for its intracellular growth and proliferation. Lysosomal trafficking regulator (LYST) is a member of the Beige and Chediak-Higashi syndrome (BEACH) family, which regulates the transport of vesicles to lysosomes and regulates TLR signaling pathway, but the effect of LYST on C. burnetii infection is unclear. In this study, a series of experiments has been conducted to investigate the influence of LYST on intracellular growth of C. burnetii. Our results showed that lyst transcription was up-regulated in the host cells after C. burnetii infection, but there is no significant change in lyst expression level after infection with the Dot/Icm type IV secretion system (T4SS) mutant strain, while CCVs expansion and significantly increasing load of C. burnetii appeared in the host cells with a silenced lyst gene, suggesting LYST inhibits the intracellular proliferation of C. burnetii by reducing CCVs size. Then, the size of CCVs and the load of C. burnetii in the HeLa cells pretreated with E-64d were significantly decreased. In addition, the level of iNOS was decreased significantly in LYST knockout THP-1 cells, which was conducive to the intracellular replication of C. burnetii. This data is consistent with the phenotype of L-NMMA-treated THP-1 cells infected with C. burnetii. Our results revealed that the upregulation of lyst transcription after infection is due to effector secretion of C. burnetii and LYST inhibit the intracellular replication of C. burnetii by reducing the size of CCVs and inducing nos2 expression.

Introduction

Coxiella burnetii, an obligate intracellular Gram-negative bacterium, is the etiological agent of Q fever (Reimer, 1993; Qin et al., 2022). In nature, arthropods (including ticks and mites) and domestic ruminants (including cattle, sheep and goats) are the main hosts of C. burnetii. The main routes of C. burnetii infection are tick bites or inhalation of contaminated aerosols (Maurin and Raoult, 1999; Raoult et al., 2005). People infected by C. burnetii cause acute Q fever clinically characterized by high fever, headache, fatigue even acute pneumonia (Vinetz et al., 2017). In rare cases, persistent infection of C. burnetii in local tissues or organs causes chronic Q fever, leading to serious complications such as pneumonia, endocarditis, myocarditis, and osteomyelitis, and will be accompanied by a higher mortality rate (Stein and Raoult, 1995; Kazar, 2005; Eldin et al., 2017; Straily et al., 2017; Ghanem-Zoubi et al., 2021). Chronic Q fever is more difficult to treat than acute Q fever, and patients often require prolonged antibiotic treatment (van Roeden et al., 2018). Serological and molecular biological studies of C. burnetii have demonstrated that it is almost distributed around the world (Georgiev et al., 2013), and many studies have reported that Q fever outbreaks and epidemics have occurred in dozens of provinces, municipalities, and autonomous regions in China, including Chongqing, Sichuan, Yunnan, Tibet, Gansu, and Guangzhou (El-Mahallawy et al., 2015a; El-Mahallawy et al., 2015b; Huang et al., 2021).

C. burnetii invades host cells through the endocytosis pathway and forms phagosomes in the cells, and C. burnetii deliver effectors into the cytosol of host cells through the Dot/Icm type IV secretion system (T4SS) to regulate various host cell functions, such as apoptosis (Lührmann et al., 2010; Klingenbeck et al., 2013; Schäfer et al., 2017), autophagy (Valdivia et al., 2014; Mansilla Pareja et al., 2017), ubiquitination (Voth et al., 2011), metabolism and vesicle transport system (Kohler and Roy, 2015), which delivers C. burnetii to lysosome, ultimately forming a specialized membrane-bound compartment called Coxiella-containing vacuole (CCV) (Beare et al., 2011; Valdivia et al., 2014; Roy et al., 2019). With the homologous fusion of CCVs and the heterologous fusion between CCVs and vesicles such as autophagosomes, lysosomes and late endocytic vesicles, a mature and single huge CCV will gradually form to provide sufficient space and nutrition for the intracellular growth of C. burnetii (Kohler and Roy, 2015).

Lysosomal transport regulatory factor (LYST) is a highly conserved homologous protein in mammals, which is classified as a member of the Beige and Chediak-Higashi syndrome (BEACH) family due to a special BEACH region (Burgess et al., 2009; Cullinane et al., 2013). LYST regulates the transport of vesicles to lysosomes in host cells (Holland et al., 2014) and specifically controls interferon regulatory factors 3 (IRF3)/TIR domain-containing adapter-inducing interferon β (TRIF-β), inducing endosomal TLR signaling pathways (Westphal et al., 2017). Inhibition of LYST function results in abnormal phagosome maturation, leading to impaired formation of activation-induced rab7+ endosomal/phagosomal compartment, which is the major milestones in the TRIF signaling pathway (Westphal et al., 2017). LYST single gene mutation will lead to abnormal autophagy and defective vesicles transport, thus giving rise to phagosome enlargement (Cullinane et al., 2013; Sepulveda et al., 2015; Lattao et al., 2021).

In this study, we found that the expression of lyst was up-regulated in host cells after infection with C. burnetii, and the up-regulation of lyst expression was closely related to the secretion of C. burnetii effector. Further investigation showed that LYST inhibited the intracellular replication of C. burnetii by restricting the enlargement of CCVs and up-regulating the expression of nos2. The findings provide a novel clue for elucidating the pathogenic mechanism of C. burnetii and identify a novel potential therapeutic target for Q fever.

Results

Promotion of C. burnetii growth in host cells with knockdown of lyst

The transcription level of lyst mRNA in C. burnetii infected Hela cells was detected at different time points. As a result, it showed that the mRNA transcription levels of lyst were approximately 6-fold increased at 24 hours after infection, compared with uninfected controls (Figure 1A), indicating that C. burnetii infection caused up-regulation of mRNA expression of lyst in HeLa cells, and this result was also obtained in THP-1 cells (Figure 2A). At 72 hours after infection with C. burnetii, a large CCV that contained the lysosomal marker Lamp1 was observed in the host cells in fluorescence confocal analysis (Figures 1B, 2B) (Roy et al., 2019).

Figure 1

Figure 2

To assess the impact of LYST on intracellular replication of C. burnetii, HeLa cells were transfected with siRNAs (siLYST-05 or siLYST-07) to silence the expression of lyst, achieving an inhibition efficiency of approximately 50% (Figure 1C). Subsequently, the lyst-silenced HeLa cells were infected with C. burnetii, and then C. burnetii load was detected. As a result, the intracellular replication level of C. burnetii was enhanced significantly in the lyst-silenced cells (Figure 1D).

THP-1 cells were notoriously difficult to transfect as almost all well-established transfection approaches (Lorkowski et al., 2014; Tang et al., 2018), so we used LYST-knockout THP-1 (purchased from Cyagen, China) to investigate the effect of LYST on the intracellular reproduction of C. burnetii in THP-1 cells. The knockout efficiency of LYST in THP-1 was about 50% by qRT-PCR and cellular immunofluorescence assay (Figures 2C–E). At the same time, C. burnetii were infected with the LYST-knockout THP-1 cells and the bacterial load of C. burnetii was significantly increased (Figure 2F).

In conclusion, the expression level of lyst was significantly up-regulated in both HeLa cells and THP-1 cells after C. burnetii infection, and C. burnetii load were significantly increased in the lyst gene knockdown/konckout host cells, suggesting that LYST inhibits intracellular replication of C. burnetii.

The level of lyst expression correlates with the Dot/Icm type IV secretion system of C. burnetii

In the course of infection, a variety of effectors of C. burnetii with different functions were delivered through T4SS and interact with the functional regulatory molecules of host cells to promote the development of CCVs and enhance its intracellular replication.

In order to explore the relationship between the up-regulation of lyst expression after infection and the secretion of C. burnetii effectors, THP-1 cells were differentiated and infected with C. burnetii pJb-TEM1-CvpE [positive control, a T4SS effector (Lührmann et al., 2010; Larson et al., 2015)], C. burnetii pJb-TEM1-Cbu1754 [negative control, a structural protein (Valdivia et al., 2014; Steiner et al., 2021)], dotA::Tn pJb-TEM1-CvpE or icmD::Tn pJb-TEM1-CvpE and subjected to TEM translocation assays according to the LiveBLAzer™ FRET—B/G Loading Kit. The results showed that dotA::Tn and icmD::Tn did not transport 3×Flag-TEM1-CvpE to the host cytoplasm (Figures 3A–C).

Figure 3

Then THP-1 cells were infected with wile type C. burnetii, dotA::Tn or icmD::Tn and the transcription level of lyst mRNA and intracellular replication level within 7 days were detected. The results showed that dotA::Tn and icmD::Tn infection had no effect on lyst expression (Figure 3D) and two strains hardly prolifed in host cells (Figure 3E), indicating that C. burnetii regulates lyst expression by effectors secretion, and affects CCVs development and intracellular replication of C. burnetii.

LYST inhibits the intracellular proliferation of C. burnetii by reducing CCVs size

With the infection of C. burnetii infection, a mature and huge CCV will gradually form in the host cell, which provides an acidic environment (pH~5.0) and adequate nutrients for the intracellular growth of C. burnetii (Kohler and Roy, 2015). After C. burnetii infection, both the CCVs size and the C. burnetii loads were significantly increased in the lyst-silenced cells compared with the unsilenced cells (Figures 4A, B), suggesting that LYST inhibits the intracellular proliferation of C. burnetii by reducing CCVs size in host cells.

Figure 4

Aloxistatin (E-64d), a cysteine proteases inhibitor, has been shown to inhibit the enlargement of cellular lysosomes (Tanabe et al., 2000; Huynh et al., 2004; Yamada et al., 2005) to restrict the intracellular proliferation of pathogenic microorganisms (Beverley et al., 2008). To investigate whether LYST hinders the intracellular replication of C. burnetii by suppressing CCVs expansion, HeLa cells were treated with E-64d and then infected with C. burnetii. The result showed that both the CCVs size and the intracellular C. burnetii load were significantly reduced in E-64d treated cells compared with the E-64d untreated cells (Figures 4C, D). These findings indicate that E-64d effectively inhibited the intracellular proliferation of C. burnetii by suppressing CCVs expansion. Furthermore, when lyst-silenced HeLa cells were pretreated with E-64d, both the CCVs size (Figures 4C, D) and the C. burnetii load (Figure 4E) were significantly reduced, also indicating that LYST plays a role in inhibiting intracellular proliferation of C. burnetii through reducing the size of CCVs.

Regulation of nos2 expression by LYST affects intracellular proliferation of C. burnetii

Inducible nitric oxide synthase (iNOS) is encoded by nitric oxide synthase 2 gene (nos2) in macrophages. It can be induced and activated by many compounds such as bacterial lipopolysaccharide (LPS), type I/II interferon, and cytokines to stimulate macrophages to release nitric oxide (NO), a powerful bactericide (Zamboni and Rabinovitch, 2004; Hill et al., 2011), which effectively inhibits the proliferation of intracellular bacteria (Howe et al., 2002; Matthiesen et al., 2023). This process is one of the important bactericidal mechanisms of macrophages (Kleinert et al., 2004; Tailleux et al., 2011; Schairer et al., 2014; Bogdan, 2015). The use of nitric oxide synthase inhibitor (NG-Monomethyl-L-arginine, L-NMMA) effectively inhibits the activity of iNOS (Chakravortty et al., 2002; Brennan et al., 2004).

To investigate the potential impact of LYST on the intracellular proliferation of C. burnetii by activating the expression of nos2, the LYST-knockout THP-1 cells were induced to adhere in advance and subsequently infected with C. burnetii. The total RNA samples extracted from the infected cells at different time points were used to detect the expression of nos2 mRNA in the host cells, and the supernatants of cell culture were quantitatively detected iNOS by ELISA. The results showed that a significant decrease both in nos2 mRNA level and iNOS content in LYST-knockdown THP-1 cells infected with C. burnetii compared with those of the infected normal THP-1 cells (Figures 5A, B).

Figure 5

Then the THP-1 cells were pretreated with L-NMMA to suppress nos2 expression with about 88% inhibition efficiency (Figure 5C). After infection with C. burnetii, the L-NMMA-treated THP-1 cells were significantly enhanced in intracellular C. burnetii load compared to that of controls (Figure 5D), suggesting that the expression of nos2 inhibits the intracellular proliferation of C. burnetii. However, there was no significant difference in intracellular C. burnetii load between LYST-knockdown THP-1 cells pretreated with L-NMMA and untreated LYST-knockdown THP-1 cells (Figure 5D), suggesting that LYST inhibits the reproduction of C. burnetii by inducing nos2 expression in host cells.

Discussion

C. burnetii is an obligate intracellular Gram-negative bacterium. After infecting host cells, it will be phagocytosed to form a phagosome which developed into CCV to provide a large and suitable environment and abundant nutrients for the growth and reproduction of C. burnetii in the cytosol of host cells (Christie et al., 2011; Kohler and Roy, 2015). Therefore, the development and maturation of CCV is a necessary for C. burnetii to multiply in host cells and sustain stable infection (Best and Abu Kwaik, 2019).

LYST, a member of the BEACH family (Cullinane et al., 2013), is a transporter protein that regulates the transport of small vesicles to lysosomes in host cells (Holland et al., 2014). Loss of functional LYST results in the abnormal maturation of phagosomes and enlargement of lysosomal associated organelles (Barbosa et al., 1996; Kaplan et al., 2008). Studies have shown that lyst gene-deficient mice exhibited increased susceptibility to bacteria (Westphal et al., 2017). Furthermore, study showed that host cells could inhibit intracellular growth of Leishmania amazonensis by suppressing the development of parasitic vesicles through LYST (Beverley et al., 2008). This process may be an innate immune response of host cells against intracellular pathogens. However, whether LYST affects the replication of C. burnetii in host cells remains unclear currently. This study aims to conduct an initial investigation into the influence of LYST on the intracellular reproduction of C. burnetii.

In our study, it was found that after infection with C. burnetii, the mRNA expression level of lyst in host cells was up-regulated, while both the CCVs size and C. burnetii load in the host cells silenced with lyst were increased significantly compared with those of the normal cell control. Therefore, it is extrapolated that LYST might inhibit the intracellular proliferation of C. burnetii by suppressing CCVs expansion after infection. This conjecture was confirmed by the experiment in the host cells pretreated with E-64d, a drug that inhibit the expansion of vesicles in cells, and the host cells pretreated with E-64d showed smaller CCVs and lower bacterial loads after infection with C. burnetii.

Since LYST can specifically affect the TLR3/TRIF-mediated endosomal TLR signal transduction pathway (Westphal et al., 2017), and the upregulation of nos2 is partly dependent on TLR3/TRIF (Zhang et al., 2016), we used RT-qPCR and ELISA to respectively detect the mRNA expression level of nos2 and iNOS content in LYST-knockout THP-1 cells infected with C. burnetii at different times. It was found that the mRNA expression level of nos2 and the content of iNOS in LYST-knockout THP-1 cells were significantly lower than those in normal THP-1 cells controls, while the loads of C. burnetii was significantly enhanced in LYST-knockout THP-1 cells and the THP-1 cells pretreated with a competitive inhibitor of nitric oxide synthase (L-NMMA).

Conclusion

In summary, our study found that the transcription of lyst, a gene previously shown to regulate lysosome size, was up-regulated in host cells after infection with C. burnetii, which were confirmed by experiments in the present study, demonstrating that the expression of lyst in host cells after infection is related to the effector secretion of C. burnetii and LYST not only inhibits the expansion of CCVs, thereby reducing the space for the growth and reproduction of C. burnetii, but also results in up-regulation of nos2 expression by activating the innate immune response of macrophages to catalyze the production of nitric oxide (NO), a key defense molecule. By the combination of the two pathways, the growth and reproduction of C. burnetii could be effectively inhibited in macrophages. Therefore, the results in the present study lay a theoretic basis for developing novel drugs against C. burnetii and providing novel therapeutic strategies for Q fever.

Materials and methods

Bacterial strains and cell culture

The C. burnetii Nine Mile RSA439, phase II strain, clone 4 (NMII) was preserved in our laboratory and propagated in freshly prepared modified acidified citrate cysteine medium (ACCM-2) at 37°C with 5% CO2 and 2.5% O2.

HeLa cells were purchased from ATCC and cultured in DMEM containing 10% fetal bovine serum (FBS) at 37°C with 5% CO2. THP-1 cells were purchased from ATCC and grown in RPMI 1640 medium with 10% FBS and 0.1% 2-mercaptoethanol at 37°C with 5% CO2.

Cell processing and immunofluorescence staining of the CCVs membrane and LYST

Before the experiment, Hela cells or THP-1 cells were seeded in a 12-well cell culture plate at the required cell density. Aloxistatin (E-64d, MCE, E8640) was added to monolayer cells at 1 μM for 4 hours prior to infection. NG-Monomethyl-L-arginine (L-NMMA, MCE, M7033) was added to monolayer cells at 50 μM for 4 hours prior to infection. Cells were washed three times with sterile PBS and then infected with C. burnetii at a multiplicity of infection (MOI) of 2.

For staining the CCVs, cells were treated as follow at 5 dpi: 1) cells were fixed with 4% paraformaldehyde for 15 minutes; 2) cells were permeabilized with 0.2% TritonX-100 for 15 minutes; 3) incubated with 1% BSA at room temperature for 30 minutes to block the cells; 4) anti-C. burnetii serum (prepared in our laboratory) and goat anti-mouse IgG Alexa Flour 594 antibody (Abcam, ab150116), anti-LAMP-1 antibody (CTS, 9091S) and goat anti-rabbit IgG Alexa Flour 488 antibody (Abcam, ab150113) were incubated successively, and each antibody was incubated at room temperature for 1 hour; 5) After washing with PBS, the cell nuclei were stained with DAPI at room temperature for 3 to 5 minutes. After each staining step, wash 3 times with sterile PBS for 5 minutes each time; 6) the coverslips were removed and mounted on slides with Prolong Gold antifade mounting solution (Thermo, p36935) to observe CCVs, and the results were photographed and saved.

For staining the LYST, THP-1 cells and LYST-KO THP-1 cells were differentiated with PMA (200 nM) for 48 h, 1) the cells were fixed, permeabilized and block (as show above); 2) anti-LYST antibody (Abcam, ab220481) and goat anti-rabbit IgG Alexa Flour 488 antibody (Abcam, ab150113) were incubated successively, and each antibody was incubated at room temperature for 1 hour; 3) follow-up operations are as described previously; 4) the relative fluorescence intensity of 488nm was calculated.

Electroporation of C. burnetii with plasmids

The pJb-TEM1-CvpE and pJb-TEM1-Cbu1754 were introduced into electrocompetent wild type C. burnetii respectively, and additionally, pJb-TEM1-CvpE was introduced into electrocompetent two T4SS mutant stains (dotA::Tn and icmD::Tn) at 1800 V, 500 Ω, 25 µF and duration between 9-13 msec. Immediately, 900 µl of RPMI 1640 medium was added into the mixture at room temperature (Bonazzi et al., 2015). Subsequently, the electroporated bacteria was inoculated into 5 ml of ACCM-2 containing 1% FBS and cultured at 37 °C, 2.5% O2, 5% CO2 for 7 days. Finally, 100 µl of the culture is coated with ACCM-2 plates containing kanamycin (375 µg/ml) and 0.2% agarose to isolate individual C. burnetii pJb-TEM1-CvpE, C. burnetii pJb-TEM1-Cbu1754, dotA::Tn pJb-TEM1-CvpE and icmD::Tn pJb-TEM1-CvpE.

TEM translocation assays

THP-1 cells were differentiated into adherent, macrophage- like cells and infected with C. burnetii strains carrying β-lactamase fusions at a MOI of 100. 6X CCF4-AM Substrate Loading Solution to cells to 1X final concentration at 1 day post infection and incubate the plate at room temperature for 60–120 minutes. Samples were observed under a fluorescence microscope and detection of the blue coumarin emission (~450 nm) and green fluorescein emission (~520 nm), and positive cells were marked blue.

Gene silencing and efficiency detection

HeLa cells were seeded in the cell culture plate at a density of 1×105 cells/ml in advance. After the cells adhere to the well, two lyst-specific siRNA (siLYST-05 and siLYST-04, Table 1) were transfected into HeLa cells with Lipofectamine RNAiMAX Reagent for 2 days. The total cellular RNA was extracted and reverse-transcribed into cDNA by TransScript one-step method. Subsequently, the cDNA was analyzed for lyst transcription levels by RT-qPCR, with the required primers listed in Table 2. The expression level was determined relative to the internal reference gene (gapdh).

Table 1

siRNASequence (5’-3’)
siLYST-05GACGUUACCUUGAAUCAUA
siLYST-07GAACCAGUGAUUAGACUUA
*siNCUUCUCCGAACGUGUCACGUTT

Sequences of siRNA for lyst gene silence.

*Negative Control: non-specific siRNA.

Table 2

PrimerSequence (5’-3’)
hlyst-RGCACATCAAGTTTGGCTTTACT
hlyst-FTACTCGAAAACCTCACTCAAGG
nos2-RGAATGTGCTGTTTGCCTCGG
nos2-FGATGGGAGAAGGGGATGAGC
hgapdh-RGGAAGATGGTGATGGGATT
hgapdh-FAACGGATTTGGTCGTATTG

Primers for RT-qPCR.

Detection of intracellular growth of C. burnetii and cell nos2 expression level

The cells were infected with C. burnetii at a MOI of 2, and then the unabsorbed C. burnetii was washed away with sterile PBS 4 hours later. Cell samples were collected every 24 hours to extract DNA, and DNA samples were detected by qPCR to determine the bacterial loads of C. burnetii (primers such as Table 3).

Table 3

PrimerSequence (5’-3’)
com1-FAAAACCTCCGCGTTGTCTTCA
com1-RGCTAATGATACTTTGGCAGCGTATTG
com1-probe5’6-FAM-AGAACTGCCCATTTTTGGCGGCCA-3’-BHQ1

Primers and probes for qPCR.

According to the above infection method, THP-1 cells were infected with C. burnetii. Total RNA was extracted at different time points after infection, and the relative expression level of nos2 was detected by RT-qPCR (required primers such as Table 2). At the same time, the supernatant of cell culture was collected and the content of iNOS was detected by Human iNOS ELISA KIT.

Statements

Data availability statement

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.

Author contributions

WW: Investigation, Methodology, Writing – original draft. SZ: Investigation, Writing – original draft. MZ: Formal analysis, Writing – original draft. XO: Formal analysis, Writing – original draft. YY: Formal analysis, Writing – original draft. XX: Formal analysis, Writing – review & editing. NZ: Writing – review & editing. JJ: Funding acquisition, Project administration, Writing – review & editing.

Funding

The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported by the National Natural Science Foundation of China [32000139] and the State Key Laboratory of Pathogen and Biosecurity (Academy of Military Medical Science) [SKLPBS2217].

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1

    BarbosaM. D. F. S.NguyenQ. A.TchernevV. T.AshleyJ. A.DetterJ. C.BlaydesS. M.et al. (1996). Identification of the homologous beige and Chediak–Higashi syndrome genes. Nature382, 262265. doi: 10.1038/382262a0

  • 2

    BeareP. A.GilkS. D.LarsonC. L.HillJ.SteadC. M.OmslandA.et al. (2011). Dot/Icm type IVB secretion system requirements for coxiella burnetii growth in human macrophages. mBio2, e00175-11. doi: 10.1128/mBio.00175-11

  • 3

    BestA.Abu KwaikY. (2019). Nutrition and bipartite metabolism of intracellular pathogens. Trends Microbiol.27, 550561. doi: 10.1016/j.tim.2018.12.012

  • 4

    BeverleyS. M.WilsonJ.HuynhC.KennedyK. A.WardD. M.KaplanJ.et al. (2008). Control of parasitophorous vacuole expansion by LYST/beige restricts the intracellular growth of leishmania amazonensis. PloS Pathog.4 (10), e1000179. doi: 10.1371/journal.ppat.1000179

  • 5

    BogdanC. (2015). Nitric oxide synthase in innate and adaptive immunity: an update. Trends Immunol.36, 161178. doi: 10.1016/j.it.2015.01.003

  • 6

    BonazziM.CantetF.MartinezE. (2015). Generation and multi-phenotypic high-content screening of coxiella burnetii transposon mutants. J. Vis. Exp. (99), e52851. doi: 10.3791/52851

  • 7

    BrennanR. E.RussellK.ZhangG.SamuelJ. E. (2004). Both inducible nitric oxide synthase and NADPH oxidase contribute to the control of virulent phase I Coxiella burnetii Infections. Infect. Immun.72, 66666675. doi: 10.1128/IAI.72.11.6666-6675.2004

  • 8

    BurgessA.MornonJ. P.de Saint-BasileG.CallebautI. (2009). A concanavalin A-like lectin domain in the CHS1/LYST protein, shared by members of the BEACH family. Bioinformatics25, 12191222. doi: 10.1093/bioinformatics/btp151

  • 9

    ChakravorttyD.Hansen-WesterI.HenselM. (2002). Salmonella pathogenicity island 2 mediates protection of intracellular salmonella from reactive nitrogen intermediates. J. Exp. Med.195, 11551166. doi: 10.1084/jem.20011547

  • 10

    ChristieP.CareyK. L.NewtonH. J.LührmannA.RoyC. R. (2011). The Coxiella burnetii Dot/Icm System Delivers a Unique Repertoire of Type IV Effectors into Host Cells and Is Required for Intracellular Replication. PloS Pathog.7 (5), e1002056. doi: 10.1371/journal.ppat.1002056

  • 11

    CullinaneA. R.SchäfferA. A.HuizingM. (2013). The BEACH is hot: A LYST of emerging roles for BEACH-domain containing proteins in human disease. Traffic14, 749766. doi: 10.1111/tra.12069

  • 12

    EldinC.MélenotteC.MediannikovO.GhigoE.MillionM.EdouardS.et al. (2017). From Q fever to coxiella burnetii infection: a paradigm change. Clin. Microbiol. Rev.30, 115190. doi: 10.1128/CMR.00045-16

  • 13

    El-MahallawyH. S.KellyP.ZhangJ.YangY.WeiL.TianL.et al. (2015a). Serological and molecular evidence of Coxiella burnetii in samples from humans and animals in China. Ann. Agric. Environ. Med.23, 8791. doi: 10.5604/12321966.1196859

  • 14

    El-MahallawyH. S.LuG.KellyP.XuD.LiY.FanW.et al. (2015b). Q fever in China: a systematic review, 1989-2013. Epidemiol. Infect.143, 673681. doi: 10.1017/S0950268814002593

  • 15

    GeorgievM.AfonsoA.NeubauerH.NeedhamH.ThiéryR.RodolakisA.et al. (2013). Q fever in humans and farm animals in four European countries, 1982 to 2010. Eurosurveillance18 (8), pii=20407. doi: 10.2807/ese.18.08.20407-en

  • 16

    Ghanem-ZoubiN.KarramT.KagnaO.MerhavG.KeidarZ.PaulM. (2021). Q fever vertebral osteomyelitis among adults: a case series and literature review. Infect. Dis.53, 231240. doi: 10.1080/23744235.2020.1871508

  • 17

    HillJ.SamuelJ. E.FangF. C. (2011). Coxiella burnetii Acid phosphatase inhibits the release of reactive oxygen intermediates in polymorphonuclear leukocytes. Infect. Immun.79, 414420. doi: 10.1128/IAI.01011-10

  • 18

    HollandP.TorgersenM. L.SandvigK.SimonsenA. (2014). LYST affects lysosome size and quantity, but not trafficking or degradation through autophagy or endocytosis. Traffic15, 13901405. doi: 10.1111/tra.12227

  • 19

    HoweD.BarrowsL. F.LindstromN. M.HeinzenR. A. (2002). Nitric oxide inhibits Coxiella burnetii Replication and parasitophorous vacuole maturation. Infect. Immun.70, 51405147. doi: 10.1128/IAI.70.9.5140-5147.2002

  • 20

    HuangM.MaJ.JiaoJ.LiC.ChenL.ZhuZ.et al. (2021). The epidemic of Q fever in 2018 to 2019 in Zhuhai city of China determined by metagenomic next-generation sequencing. PloS Negl. Trop. Dis.15 (7), e0009520. doi: 10.1371/journal.pntd.0009520

  • 21

    HuynhC.RothD.WardD. M.KaplanJ.AndrewsN. W. (2004). Defective lysosomal exocytosis and plasma membrane repair in Chediak–Higashi/beige cells. Proc. Natl. Acad. Sci.101, 1679516800. doi: 10.1073/pnas.0405905101

  • 22

    KaplanJ.De DomenicoI.WardD. M. (2008). Chediak-higashi syndrome. Curr. Opin. Hematol.15, 2229. doi: 10.1097/MOH.0b013e3282f2bcce

  • 23

    KazarJ. (2005). Coxiella burnetii infection. Ann. New York Acad. Sci.1063, 105114. doi: 10.1196/annals.1355.018

  • 24

    KleinertH.PautzA.LinkerK.SchwarzP. M. (2004). Regulation of the expression of inducible nitric oxide synthase. Eur. J. Pharmacol.500, 255266. doi: 10.1016/j.ejphar.2004.07.030

  • 25

    KlingenbeckL.EckartR. A.BerensC.LührmannA. (2013). The Coxiella burnetii type IV secretion system substrate CaeB inhibits intrinsic apoptosis at the mitochondrial level. Cell. Microbiol.15, 675687. doi: 10.1111/cmi.12066

  • 26

    KohlerL. J.RoyC. R. (2015). Biogenesis of the lysosome-derived vacuole containing Coxiella burnetii. Microbes Infect.17, 766771. doi: 10.1016/j.micinf.2015.08.006

  • 27

    LarsonC. L.BeareP. A.VothD. E.HoweD.CockrellD. C.BastidasR. J.et al. (2015). Coxiella burnetii effector proteins that localize to the parasitophorous vacuole membrane promote intracellular replication. Infect. Immun.83, 661670. doi: 10.1128/IAI.02763-14

  • 28

    LattaoR.RangoneH.LlamazaresS.GloverD. M. (2021). Mauve/LYST limits fusion of lysosome-related organelles and promotes centrosomal recruitment of microtubule nucleating proteins. Dev. Cell56, 10001013.e6. doi: 10.1016/j.devcel.2021.02.019

  • 29

    LorkowskiS.WittigB.MaeßM. B. (2014). Highly efficient transfection of human THP-1 macrophages by nucleofection. J. Vis. Exp. (91), e51960. doi: 10.3791/51960

  • 30

    LührmannA.NogueiraC. V.CareyK. L.RoyC. R. (2010). Inhibition of pathogen-induced apoptosis by a Coxiella burnetii type IV effector protein. Proc. Natl. Acad. Sci.107, 1899719001. doi: 10.1073/pnas.1004380107

  • 31

    Mansilla ParejaM. E.BongiovanniA.LafontF.ColomboM. I. (2017). Alterations of the coxiella burnetii replicative vacuole membrane integrity and interplay with the autophagy pathway. Front. Cell Infect. Microbiol.7, 112. doi: 10.3389/fcimb.2017.00112

  • 32

    MatthiesenS.ChristiansenB.JahnkeR.ZaeckL. M.KargerA.FinkeS.et al. (2023). TGF-β/IFN-γ Antagonism in subversion and self-defense of phase II coxiella burnetii-infected dendritic cells. Infect. Immun.91, e0032322. doi: 10.1128/iai.00323-22

  • 33

    MaurinM.RaoultD. (1999). Q fever. Clin. Microbiol. Rev.12, 518553. doi: 10.1128/CMR.12.4.518

  • 34

    QinT.ShiM.LiuZ.FengH.SunY. (2022). Molecular Detection of Candidatus Coxiella mudorwiae in Haemaphysalis concinna in China. Zoonoses2 (1). doi: 10.15212/ZOONOSES-2022-0041

  • 35

    RaoultD.MarrieT. J.MegeJ. L. (2005). Natural history and pathophysiology of Q fever. Lancet Infect. Dis.5, 219226. doi: 10.1016/S1473-3099(05)70052-9

  • 36

    ReimerL. G. (1993). Q fever. Clin. Microbiol. Rev.6, 193198. doi: 10.1128/CMR.6.3.193

  • 37

    RoyC. R.SamantaD.ClementeT. M.SchulerB. E.GilkS. D. (2019). Coxiella burnetii Type 4B Secretion System-dependent manipulation of endolysosomal maturation is required for bacterial growth. PloS Pathog.15 (12), e1007855. doi: 10.1371/journal.ppat.1007855

  • 38

    SchäferW.EckartR. A.SchmidB.CagköylüH.HofK.MullerY. A.et al. (2017). Nuclear trafficking of the anti-apoptotic Coxiella burnetii effector protein AnkG requires binding to p32 and Importin-α1. Cell. Microbiol.19 (1). doi: 10.1111/cmi.12634

  • 39

    SchairerD. O.ChouakeJ. S.NosanchukJ. D.FriedmanA. J. (2014). The potential of nitric oxide releasing therapies as antimicrobial agents. Virulence3, 271279. doi: 10.4161/viru.20328

  • 40

    SepulvedaF. E.BurgessA.HeiligensteinX.GoudinN.MénagerM. M.RomaoM.et al. (2015). LYST controls the biogenesis of the endosomal compartment required for secretory lysosome function. Traffic16, 191203. doi: 10.1111/tra.12244

  • 41

    SteinA.RaoultD. (1995). Q fever endocarditis. Eur. Heart J.16, 1923. doi: 10.1093/eurheartj/16.suppl_B.19

  • 42

    SteinerS.MeirA.RoyC. R. (2021). Coxiella burnetii encodes an LvgA-related protein important for intracellular replication. Cell. Microbiol. 23 (6), e13331. doi: 10.1111/cmi.13331

  • 43

    StrailyA.DahlgrenF. S.PetersonA.PaddockC. D. (2017). Surveillance for Q fever endocarditis in the United States, 1999–2015. Clin. Infect. Dis.65, 18721877. doi: 10.1093/cid/cix702

  • 44

    TailleuxL.HerbstS.SchaibleU. E.SchneiderB. E. (2011). Interferon gamma activated macrophages kill mycobacteria by nitric oxide induced apoptosis. PloS One. 6 (5), e19105. doi: 10.1371/journal

  • 45

    TanabeF.CuiS.-H.ItoM. (2000). Abnormal down-regulation of PKC is responsible for giant granule formation in fibroblasts from CHS (beige) mice—a thiol proteinase inhibitor, E-64-d, prevents giant granule formation in beige fibroblasts. J. Leukocyte Biol.67, 749755. doi: 10.1002/jlb.67.5.749

  • 46

    TangX.AljahdaliB.AlasiriM.BamashmousA.CaoF.DibartS.et al. (2018). A method for high transfection efficiency in THP-1 suspension cells without PMA treatment. Anal. Biochem.544, 9397. doi: 10.1016/j.ab.2017.12.032

  • 47

    ValdiviaR. H.NewtonH. J.KohlerL. J.McDonoughJ. A.Temoche-DiazM.CrabillE.et al. (2014). A screen of coxiella burnetii mutants reveals important roles for Dot/Icm effectors and host autophagy in vacuole biogenesis. PloS Pathog.10 (7), e1004286. doi: 10.1371/journal.ppat.1004286

  • 48

    van RoedenS. E.ReukersD. F. M.van JaarsveldC. H. M.KampschreurL. M.HoepelmanI. M.WeverP. C.et al. (2018). Chronic Q fever: patient and treatment-related factors influencing long-term quality of life. Qjm111, 791797. doi: 10.1093/qjmed/hcy171

  • 49

    VinetzJ. M.EsmaeiliS.GolzarF.AyubiE.NaghiliB.MostafaviE. (2017). Acute Q fever in febrile patients in northwestern of Iran. PloS Negl. Trop. Dis.11 (4), e0005535. doi: 10.1371/journal.pntd.0005535

  • 50

    VothD. E.BeareP. A.HoweD.SharmaU. M.SamoilisG.CockrellD. C.et al. (2011). The coxiella burnetii cryptic plasmid is enriched in genes encoding type IV secretion system substrates. J. Bacteriol.193, 14931503. doi: 10.1128/JB.01359-10

  • 51

    WestphalA.ChengW.YuJ.GrasslG.KrautkrämerM.HolstO.et al. (2017). Lysosomal trafficking regulator Lyst links membrane trafficking to toll-like receptor–mediated inflammatory responses. J. Exp. Med.214, 227244. doi: 10.1084/jem.20141461

  • 52

    YamadaK.FujiK.ShimadaT.NishimuraM.Hara-NishimuraI. (2005). Endosomal proteases facilitate the fusion of endosomes with vacuoles at the final step of the endocytotic pathway. Plant J.41, 888898. doi: 10.1111/j.1365-313X.2005.02349.x

  • 53

    ZamboniD. S.RabinovitchM. (2004). Phagocytosis of apoptotic cells increases the susceptibility of macrophages to infection with Coxiella burnetii phase II through down-modulation of nitric oxide production. Infect. Immun.72, 20752080. doi: 10.1128/IAI.72.4.2075-2080.2004

  • 54

    ZhangL.XiangW.WangG.YanZ.ZhuZ.GuoZ.et al. (2016). Interferon β (IFN-β) Production during the Double-stranded RNA (dsRNA) Response in Hepatocytes Involves Coordinated and Feedforward Signaling through Toll-like Receptor 3 (TLR3), RNA-dependent Protein Kinase (PKR), Inducible Nitric Oxide Synthase (iNOS), and Src Protein. J. Biol. Chem.291, 1509315107. doi: 10.1074/jbc.M116.717942

Summary

Keywords

Coxiella burnetii, lysosomal trafficking regulator, Coxiella-containing vacuole, Dot/Icm type IV secretion system, inducible nitric oxide synthase

Citation

Wan W, Zhang S, Zhao M, OuYang X, Yu Y, Xiong X, Zhao N and Jiao J (2024) Lysosomal trafficking regulator restricts intracellular growth of Coxiella burnetii by inhibiting the expansion of Coxiella-containing vacuole and upregulating nos2 expression. Front. Cell. Infect. Microbiol. 13:1336600. doi: 10.3389/fcimb.2023.1336600

Received

11 November 2023

Accepted

26 December 2023

Published

11 January 2024

Volume

13 - 2023

Edited by

Yong Zhang, Jilin University, China

Reviewed by

Wenping Gong, The 8th Medical Center of PLA General Hospital, China

Chuang Li, Purdue University, United States

Updates

Copyright

*Correspondence: Jun Jiao,

†These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics