Abstract
The olfactory system serves a vital role in the evolution and survival of insects, being involved in behaviors such as host seeking, foraging, mating, and oviposition. Odorant-binding proteins (OBPs) and chemosensory proteins (CSPs) are involved in the olfactory recognition process. In this study, BtabCSP11, a CSP11 gene from the whitefly Bemisia tabaci, was cloned and characterized. The open reading frame of BtabCSP11 encodes 136 amino acids, with four highly conserved cysteine residues. The temporal and spatial expression profiles showed that BtabCSP11 was highly expressed in the abdomens of B. tabaci females. Dietary RNA interference (RNAi)-based functional analysis showed substantially reduced fecundity in parthenogenetically reproduced females, suggesting a potential role of BtabCSP11 in B. tabaci reproduction. These combined results expand the function of CSPs beyond chemosensation.
Introduction
The insect olfactory system is used extensively in a variety of contexts, such as during host seeking, foraging, mating, and oviposition behaviors. Odorant-binding proteins (OBPs) and chemosensory proteins (CSPs) are involved in the olfactory recognition process (Pelosi et al., 2014, 2018). Both OBPs and CSPs are globular water-soluble acidic proteins with low isoelectric points found at high concentrations surrounding the chemosensory neurons (Pelosi et al., 2006). However, CSPs share minimal sequence similarity with OBPs. Generally, CSPs appear to be more conserved and are usually smaller (10–15 kDa) than OBPs (15–17 kDa). All CSPs possess four conserved cysteines (Pelosi et al., 2018). Previous studies have shown that CSPs are widely distributed in chemosensory organs, excluding the antennae (Maleszka and Stange, 1997; Nagnan-Le Meillour et al., 2000; Jin et al., 2005). In addition, CSPs are broadly expressed in non-chemosensory tissue, such as the subcuticular layer and wings (Marchese et al., 2000; Ban et al., 2003; Lu et al., 2007). The ubiquitous expression of CSPs suggests that, in addition to their known role in chemosensation, CSPs are involved in other physiological functions. In the honeybee, Apis mellifera, and the diamondback moth, Plutella xylostella, CSPs play a role in embryonic development (Maleszka et al., 2007; Gong et al., 2010). In addition, CSPs are involved in insecticide resistance in the whitefly Bemisia. tabaci and the mosquito Anopheles gambiae (Liu et al., 2014, 2016; Ingham et al., 2019). CSP3 knockdown reduced female survival and reproduction in the beet armyworm, Spodoptera exigua (Gong et al., 2012). Pheromone production, sexual behavior, mating, ovulation and oviposition are the main reproductive events. These events play roles in regulation of reproduction in insects (Raabe, 1987). Several studies have reported that insect CSPs can bind sex pheromone analogs and involved in reproduction (Dani et al., 2011; Iovinella et al., 2013).
The whitefly species Bemisia tabaci, one of the world’s most invasive agricultural pests, causes substantial crop losses worldwide by feeding on phloem and transmitting plant viruses. Bemisia Middle East-Asia Minor1 (MEAM1 or “B”) and Mediterranean (MED or “Q”) are the two most invasive biotypes, and have invaded nearly 60 countries in the past two decades (De Barro et al., 2011; Gilbertson et al., 2015; Wan and Yang, 2016). Because of its short life cycle and high fecundity, whitefly management has been extremely challenging. Whitefly control has relied predominantly on synthetic insecticides. Due to overuse, B. tabaci has developed resistance to most commercially available insecticides, particularly the neonicotinoids (Elbert and Nauen, 2000; Horowitz et al., 2004; Wang et al., 2010; Zheng et al., 2017). Therefore, new control alternatives, such as RNA interference (RNAi), are urgently needed.
RNAi has shown potential as a viable control alternative for agricultural pests (Upadhyay et al., 2011). Baum et al. showed a significant reduction in root damage caused by the Western corn rootworm, Diabrotica virgifera virgifera, by feeding larvae insecticidal dsRNAs in a growth chamber assay (Baum et al., 2007). In the meantime, Mao et al. (2007) demonstrated that larval growth in the cotton bollworm, Helicoverpa armigera, was arrested when fed transgenic leaves containing dsRNA corresponding to a detoxification enzyme gene. Both of these studies suggest that RNAi can be exploited to control insect pests. Similarly, studies on B. tabaci suggest that this biotechnology has potential in controlling them as well (Ghanim et al., 2007; Upadhyay et al., 2011).
Prior research has documented CSPs in the B. tabaci MEAM1 and MED biotypes (Li et al., 2012; Liu et al., 2016; Wang et al., 2017; Zeng et al., 2019). Functional analyses, however, are limited. In this study, we explored the function of BtabCSP11 in B. tabaci. Based on previous research, we hypothesized that BtabCSP11 is associated with reproductive behavior in B. tabaci. To test this hypothesis, we carried out the following experiments: (1) we cloned and analyzed the structure of BtabCSP11, and constructed a phylogenetic tree to analyze its evolutionary relationship with other insect CSPs; (2) we measured the temporospatial distribution of BtabCSP11 throughout different developmental stages and across different tissue types; and finally (3) we investigated the function of BtabCSP11 using dietary RNAi.
Materials and Methods
Bemisia tabaci Maintenance and Sample Collection
Bemisia tabaci MED populations were maintained on cotton plants at 27 ± 1°C under a L:D 16:8 photoperiod and 70 ± 10% relative humidity (RH). The identities of these strains were monitored every three generations using a mitochondrial marker, cytochrome oxidase I (mtCO I) (Chu et al., 2010). Different developmental stages, including eggs, the four nymphal stages, and adult females and males; and adult tissue types, including head, abdomen and a mixture of thorax, legs and wings, were collected separately from three B. tabaci MED populations. A total of 500 B. tabaci were collected per replicate for the egg and four nymphal stages, while 100 individuals were collected per replicate for adult females and males. Three independent biological replicates were used for each sample. Samples were rapidly frozen in liquid nitrogen and stored at -80°C for the subsequent RT-qPCR analyses.
RNA Extraction, cDNA Synthesis, and Molecular Cloning of BtabCSP11
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA was quantified using a NanoDrop 2000 (Thermo Scientific, Wilmington, DE, United States), and integrity was checked with 1% Tris/borate/EDTA (TBE) agarose gel electrophoresis. For gene cloning and RT-qPCR analysis, first-strand cDNA was synthesized using 1 μg of total RNA with the PrimeScript® RT reagent kit (TaKaRa Biotech, Kyoto, Japan) following the manufacturer’s recommendations. The synthesized first-strand cDNA was either used immediately or stored at −20°C for later use. We obtained the full-length sequence of BtabCSP11 from the B. tabaci MED genome and transcriptome (Xie et al., 2017).
Sequence Analysis
The program SignalPV5.01 was used to predict the putative N-terminal signal peptides and cleavage sites of BtabCSP11. The occurrence of α-helices and molecular weight were predicted using ExPASy2. The CSPs of other insect species discussed in this study were retrieved from the NCBI database. ClustalW was used to align the sequences with default gap penalty parameters of gap opening = 10 and extension = 0.2. An alignment graph was generated using WebLogo.
Phylogenetic Analysis
A neighbor-joining tree was constructed using MEGA 6.0 with a p-distance model and pairwise deletion of gaps (Tamura et al., 2013). The bootstrap support of tree branches was assessed by resampling amino acid positions 1,000 times. Sequences used in the phylogenetic analysis were open reading frames (Supplementary Table S1). Phylogenetic trees were then presented in circular shape and colored taxonomically using online tools provided by Evolview (He et al., 2016).
Expression Profiles of BtabCSP11
Expression profiles of BtabCSP11 throughout different developmental stages of B. tabaci MED were obtained using transcriptome data (SRP064690). In addition, we validated transcriptomic profiles using RT-qPCR analysis (Zeng et al., 2019). Five two-fold serial dilutions of whitefly cDNA template were used to determine RT-qPCR primer amplification efficiencies through dissociation curve analysis. Only primers with 90–110% amplification efficiencies were used for subsequent analysis. Relative quantification was calculated using the 2–ΔΔCt method, and mRNA expression values were normalized to the recommended reference genes EF1-α, SDHA and Actin (Li et al., 2013). Three biological and four technical replicates were used for each sample. Significant differences between samples were determined using one-way ANOVA with Tukey’s HSD test. SPSS20.0 was used to analyze correlations between RT-qPCR and RNA-seq data.
Dietary RNAi
dsRNA primers of BtabCSP11 and EGFP (GenBank: KC896843) with a T7 promoter sequence were designed using Primer Premier 5.0 (Table 1). dsRNAs of BtabCSP11 and EGFP were synthesized using the T7 RibomaxTM Express RNAi System (Promega, Madison, WI, United States). The quality of dsRNA was evaluated by gel electrophoresis, and dsRNA concentration was quantified using a NanoDrop spectrophotometer.
TABLE 1
| Primer Name | Anneal Temp (°C) | Primer Sequence (5′–3′) |
| RACE PCR | ||
| BtabCSP11-F | 58 | CGTTTGGGCGTCTTGATG |
| BtabCSP11-R | 58 | GCAACTCAGACCGGGGAC |
| RT-qPCR | ||
| BtabCSP11-F-RT | 60 | GTCCTTGCACTAACGAGGGG |
| BtabCSP11-R-RT | 60 | AACTGTGCGCACTATCCTCC |
| EF-1a-F | 60 | TAGCCTTGTGCCAATTTCCG |
| EF-1a-R | 60 | CCTTCAGCATTACCGTCC |
| Actin-F | 60 | TCTTCCAGCCATCCTTCTTG |
| Actin-R | 60 | CGGTGATTTCCTTCTGCATT |
| SDHA-F | 60 | GCGACTGATTCTTCTCCTGC |
| SDHA-R | 60 | TGGTGCCAACAGATTAGGTGC |
| Dietary RNAi | ||
| dsBtabCSP11-F | 58 | TAATACGACTCACTATAGGGA GATCCGCCATTAGTGATGATGA |
| dsBtabCSP11-R | 58 | TAATACGACTCACTATAGGGA GATGTCTTCGTCCATGAACTCG |
| dsEGFP-F | 58 | TAATACGACTCACTATAGGG TGAGCAAGGGCGAGGAG |
| dsEGFP-R | 58 | TAATACGACTCACTATAGGGCG GCGGTCACGAACTCCAG |
Primers used for this study.
Anneal temp: annealing temperature.
Knockdown of BtabCSP11 was performed by orally feeding dsRNAs to B. tabaci MED adult females in a feeding chamber. The feeding chambers contained 200 μL of diet solution, which consisted of 30% sucrose, 5% yeast extract (weight/volume), ddH2O and 0.5 μg/μL dsBtabCSP11. Approximately 45 newly emerged (<2 days old) B. tabaci MED adult females were released into the feeding chambers, and were kept at 25°C, 80% RH, and a L:D 16:8 photoperiod. The effectiveness of RNAi was evaluated by RT-qPCR 2 days post-feeding. Each RNAi treatment was repeated six times.
Oviposition Bioassay
After feeding, fecundity (Berger et al., 2008), i.e., the number of eggs laid per adult female, was counted at day 1, 3, 7, and 10. Fresh cotton leaves were provided every day. Bemisia tabaci reproduction was recorded as the mean number of eggs per surviving whitefly laid. A total of six independent biological replicates were used for each sample. Data were analyzed with SPSS20.0. Differences among treatments were evaluated using one-way ANOVA with Tukey’s HSD test. Figures were generated using SigmaPlot 12.5.
Results
Identification and Sequence Analysis of BtabCSP11
The full-length cDNA of BtabCSP11 contains a 408 bp open reading frame (ORF) encoding 136 amino acids (GenBank number: XP_018916537.1) with a 16.2 kDa molecular weight. There is a signal peptide with 18 residues at the N-terminus of BtabCSP11. Consistent with a classical model Cys-X6-8-Cys-X16-21-Cys-X2-4-Cys, BtabCSP11 has four conserved cysteine residues and six α-helices (Figure 1 and Supplementary Figure S1).
FIGURE 1
The CSP11 genes of other insect species were chosen for multiple sequence alignment with BtabCSP11 (Supplementary Table S1). A total of seven CSPs with >40% sequence similarity with BtabCSP11 (Pelosi et al., 2018), including DhouCSP, DvitCSP8, DkikCSP, CmedCSP3, PrapCSP10, and CbowCSP7, were included in the WebLogo alignment (Figure 1). The results of the alignment showed four highly conserved cysteine residues at positions 67, 74, 94, and 97; other positions such as 35 (Y), 50 (D), 57 (N), 64 (Y), 66 (K), 72 (G), 73 (P), 75 (T), 77 (E), 82 (K), 87 (P), 108 (V), 126 (K), 128 (D), and 133 (Y) were also highly conserved. The complete sequence alignment including all insect CSP11s is displayed in Supplementary Figure S1. Phylogenetic analysis indicated that the hemipteran CSPs formed four large branches, of which BtabCSP11, MperCSP4, DvitCSP8, and AgosCSP8 were clustered into one group (Figure 2).
FIGURE 2
Temporospatial Expression Profiles of BtabCSP11
The transcriptomic profiles of BtabCSP11 were confirmed by RT-qPCR analysis (P < 0.05 r = 0.908, Figure 3A). Among different developmental stages, BtabCSP11 expression was significantly higher in adult females (F = 76.988, P < 0.0001), and there were no significant differences among the remaining developmental stages (Figure 3A). Among different tissue types, BtabCSP11 expression was significantly higher in abdomen tissue than in head and thorax tissue (Figure 3B).
FIGURE 3
Functional Analysis of BtabCSP11
To explore the function of BtabCSP11 in B. tabaci, we silenced this gene using dietary RNAi. In comparison to control groups, BtabCSP11 expression in dsBtabCSP11-treated groups was suppressed significantly at 48 h post-feeding (Figure 4A). The total number of eggs laid by dsBtabCSP11 females at days 1, 3, 7, and 10 post-feeding was significantly lower than that in controls (P < 0.05; Figure 4B). There was no significant difference in hatching rate between the treatment (dsBtabCSP11) and control (dsEGFP) groups (Figure 4C).
FIGURE 4
Discussion
In this study, we analyzed the genetic sequence of BtabCSP11 in B. tabaci and found that BtabCSP11 has four conserved cysteines and six helices connected by α-α loops (Wanner et al., 2004). BtabCSP11 displayed about 40% sequence similarity to the CSPs of phylogenetically distant species such as the cabbage beetle Colaphellus bowringi (Pelosi et al., 2005, 2018).
Kulmuni and Havukainen (2013) showed that 5-helical CSPs are the only highly conserved CSPs in Arthropoda and are likely involved in functions other than chemosensation, whereas the vastly divergent 6-helical CSPs carry out solely chemosensory functions. Evidence strongly suggests that CSPs might be involved in chemodetection, as are OBPs (Waris et al., 2018, 2020b). In the honeybee, CSP3 specifically binds some components of brood pheromone (Briand et al., 2002). In the paper wasp Polistes dominulus (Calvello et al., 2003), the tsetse fly Glossina morsitans morsitans (Liu et al., 2012), and several species of ants, some CSPs are specifically expressed in antennae (McKenzie et al., 2014) and have been proposed to be associated with host-seeking behavior. In the plant bug Adelphocoris lineolatus, three CSPs have high binding affinity with host-related chemicals (Gu et al., 2012). Similarly, SinfCSP19 plays a role in the reception of host plant volatiles by the stem borer Sesamia inferens (Zhang et al., 2014). In the planthopper Nilaparvata lugens, NlugCSP10 may detect volatiles emitted from host plants (Waris et al., 2020a). In addition to host plant volatiles, study has reported that insect CSPs can bind β-carotene (Zhu et al., 2016).
CSPs are widely expressed in the head, thorax, abdomen, legs, wings, testes and ovaries (Gong et al., 2007; Lu et al., 2007). This expression pattern indicates that CSPs may be involved in a variety of physiological processes. Previous reports show that CSPs have many functions outside of simply transporting and binding odor molecules. For example, studies have shown that CSPs are involved in the growth and development of honeybees, the molting process of ant larvae, the reproduction of the beet armyworm S. exigua, and insecticide resistance in the mosquito A. gambiae (Maleszka et al., 2007; Gong et al., 2012; Pelosi et al., 2018; Ingham et al., 2019). Inhibition of CSP9 expression by RNAi affects fatty acid biosynthesis and prevents cuticle development in the fire ant Solenopsis invicta (Cheng et al., 2015). In addition, some CSPs act as carriers of visual pigments, as in the cotton bollworm, Helicoverpa armigera (Zhu et al., 2016). CSPs have also been found to play roles in the reproductive processes of insects, such that a decrease in CSP gene expression negatively affects reproduction (Gong et al., 2012; Ma et al., 2019).
Given that phylogenetic analysis clustered BtabCSP11 with MperCSP4, DvitCSP8, and AgosCSP8, additional functional studies are warranted to resolve the evolutionary relationship within this group. This kind of evolutionary relationship also occurs among other insects (Vieira and Rozas, 2011; Eyun et al., 2017). Additional functional studies should be carried out to understand the evolutionary history of CSPs in Hemiptera.
Our temporospatial distribution study demonstrated that BtabCSP11 was highly expressed in the abdomens of adult females, suggesting a potential role in reproduction. Our dietary RNAi-based functional study confirmed that silencing of BtabCSP11 significantly reduced oviposition in B. tabaci (Figure 4). Similarly, Gong et al. (2012) reported that silencing of CSP3 in S. exigua led to a 71.4% reduction in oviposition in comparison to uninjected controls. In addition, silencing of CSP12 in the leaf beetle Ophraella communa resulted in a 28% reduction in the number of eggs laid (Ma et al., 2019). Potential causes for this change include altered reproductive behavior (e.g., mating and oviposition). In this study, however, males were not included and females were not provided a choice of oviposition site. Therefore, we hypothesize that BtabCSP11 may affect the oviposition behavior of B. tabaci.
Statements
Data availability statement
All datasets generated for this study are included in the article/Supplementary Material.
Author contributions
The research was designed by WX and YJZ. The experiments were conceived by YZ. Data was analyzed by YZ, LK, and XZ. Manuscript was drafted by YZ. Manuscript was revised and finalized by WX, XZ, AM, SW, QW, LK, and YJZ. All authors contributed to the article and approved the submitted version.
Funding
This research was supported by the National Key R&D Program of China (2019YFD1002100), the National Natural Science Foundation of China (31672032 and 31871970), China Agriculture Research System (CARS-24-C-02), the Beijing Key Laboratory for Pest Control and Sustainable Cultivation of Vegetables and the Science, and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (CAAS-ASTIP-IVFCAAS).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphys.2020.00709/full#supplementary-material
References
1
BanL.ScaloniA.BrandazzaA.AngeliS.ZhangL.YanY.et al (2003). Chemosensory proteins of Locusta migratoria.Insect Mol. Biol.12125–134. 10.1046/j.1365-2583.2003.00394.x
2
BaumJ. A.BogaertT.ClintonW.HeckG. R.FeldmannP.IlaganO.et al (2007). Control of coleopteran insect pests through RNA interference.Nat. Biotechnol.251322–1326. 10.1038/nbt1359
3
BergerD.WaltersR.GotthardK. (2008). What limits insect fecundity? Body size- and temperature-dependent egg maturation and oviposition in a butterfly.Funct. Ecol.22523–529. 10.1111/j.1365-2435.2008.01392.x
4
BriandL.NespoulousC.HuetJ. C.TakahashiM.PernolletJ. C. (2002). Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier.Eur. J. Biochem.2694586–4596. 10.1046/j.1432-1033.2002.03156.x
5
CalvelloM.GuerraN.BrandazzaA.D’ambrosioC.ScaloniA.DaniF.et al (2003). Soluble proteins of chemical communication in the social wasp Polistes dominulus.Cell Mol. Life Sci.601933–1943. 10.1007/s00018-003-3186-5
6
ChengD.LuY.ZengL.LiangG.HeX. (2015). Si-CSP9 regulates the integument and moulting process of larvae in the red imported ?re ant, Solenopsis invicta.Sci. Rep.5:9245. 10.1038/srep09245
7
ChuD.WanF. H.ZhangY. J.BrownJ. K. (2010). Change in the biotype composition of Bemisia tabaci in Shandong province of China from 2005 to 2008.Environ. Entomol.391028–1036. 10.1603/En09161
8
CuiH. H.GuS. H.ZhuX. Q.WeiY.LiuH. W.KhalidH. D.et al (2017). Odorant-binding and chemosensory proteins identified in the antennal transcriptome of Adelphocoris suturalis Jakovlev.Comp. Biochem. Physiol. Part D Genomics Proteomics24139–145. 10.1016/j.cbd.2016.03.001
9
DaniF. R.MichelucciE.FranceseS.MastrobuoniG.CappellozzaS.La MarcaG.et al (2011). Odorant-binding proteins and chemosensory proteins in pheromone detection and release in the silkmoth Bombyx mori.Chem. Senses36335–344. 10.1093/chemse/bjq137
10
De BarroP. J.LiuS. S.BoykinL. M.DinsdaleA. B. (2011). Bemisia tabaci: a statement of species status.Annu. Rev. Entomol.561–19. 10.1146/annurev-ento-112408-085504
11
ElbertA.NauenR. (2000). Resistance of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides in southern Spain with special reference to neonicotinoids.Pest Manag. Sci.5660–64. 10.1002/(SICI)1526-4998(200001)56:1<60::AID-PS88<3.0.CO;2-K
12
EyunS. I.SohH. Y.PosaviM.MunroJ. B.HughesD. S. T.MuraliS. C.et al (2017). Evolutionary history of chemosensory-related gene families across the arthropoda.Mol. Biol. Evol.341838–1862. 10.1093/molbev/msx147
13
GhanimM.KontsedalovS.CzosnekH. (2007). Tissue-specific gene silencing by RNA interference in the whitefly Bemisia tabaci (Gennadius).Insect Biochem. Mol. Biol.37732–738. 10.1016/j.ibmb.2007.04.006
14
GilbertsonR. L.BatumanO.WebsterC. G.AdkinsS. (2015). Role of the insect supervectors Bemisia tabaci and Frankliniella occidentalis in the emergence and global spread of plant viruses.Annu. Rev. Virol.267–93. 10.1146/annurev-virology-031413-085410
15
GongD. P.ZhangH. J.ZhaoP.LinY.XiaQ. Y.XiangZ. H. (2007). Identification and expression pattern of the chemosensory protein gene family in the silkworm, Bombyx mori.Insect Biochem. Mol. Biol.37266–277. 10.1016/j.ibmb.2006.11.012
16
GongL.LuoQ.Rizwan-ul-HaqM.HuM. Y. (2012). Cloning and characterization of three chemosensory proteins from Spodoptera exigua and effects of gene silencing on female survival and reproduction.Bull. Entomol. Res.102600–609. 10.1017/S0007485312000168
17
GongL.ZhongG. H.HuM. Y.LuoQ.RenZ. Z. (2010). Molecular cloning, expression profile and 5’ regulatory region analysis of two chemosensory protein genes from the diamondback moth, Plutella xylostella.J. Insect Sci.101–15. 10.1673/031.010.14103
18
GuS. H.WangS. Y.ZhangX. Y.JiP.LiuJ. T.WangG. R.et al (2012). Functional characterizations of chemosensory proteins of the alfalfa plant bug Adelphocoris lineolatus indicate their involvement in host recognition.PLoS One7:e42871. 10.1371/journal.pone.0042871
19
GuS. H.WuK. M.GuoY. Y.FieldL. M.PickettJ. A.ZhangY. J.et al (2013). Identification and expression profiling of odorant binding proteins and chemosensory proteins between two wingless morphs and a winged morph of the cotton aphid Aphis gossypii Glover.PLoS One8:e73524. 10.1371/journal.pone.0073524
20
HeZ. L.ZhangH. K.GaoS. H.LercherM. J.ChenW. H.HuS. N. (2016). Evolview v2: an online visualization and management tool for customized and annotated phylogenetic trees.Nucleic Acids Res.44W236–W241. 10.1093/nar/gkw370
21
HorowitzA. R.KontsedalovS.IshaayaI. (2004). Dynamics of resistance to the neonicotinoids acetamiprid and thiamethoxam in Bemisia tabaci (Homoptera: Aleyrodidae).J. Econ. Entomol.972051–2056. 10.1093/jee/97.6.2051
22
InghamV. A.AnthousiA.DourisV.HardingN. J.LycettG.MorrisM.et al (2019). A sensory appendage protein protects malaria vectors from pyrethroids.Nature577376–380. 10.1038/s41586-019-1864-1
23
IovinellaI.BozzaF.CaputoB.della TorreA.PelosiP. (2013). Ligand-binding study of Anopheles gambiae chemosensory proteins.Chem. Senses38409–419. 10.1093/chemse/bjt012
24
JinX.BrandazzaA.NavarriniA.BanL.ZhangS.SteinbrechtR. A.et al (2005). Expression and immunolocalisation of odorant-binding and chemosensory proteins in locusts.Cell Mol. Life Sci.621156–1166. 10.1007/s00018-005-5014-6
25
KulmuniJ.HavukainenH. (2013). Insights into the evolution of the CSP gene family through the integration of evolutionary analysis and comparative protein modeling.PLoS One8:e63688. 10.1371/journal.pone.0063688
26
LiR.XieW.WangS.WuQ.YangN.YangX.et al (2013). Reference gene selection for qRT-PCR analysis in the sweetpotato whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae).PLoS One8:e53006. 10.1371/journal.pone.0053006
27
LiY.QinY.GaoZ.DangZ.PanW.XuG. (2012). Cloning, expression and characterisation of a novel gene encoding a chemosensory protein from Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae).Afr. J. Biotechnol.11758–770. 10.5897/AJB11.573
28
LiuG.MaH.XieH.XuanN.GuoX.FanZ.et al (2016). Biotype characterization, developmental profiling, insecticide response and binding property of Bemisia tabaci chemosensory proteins: role of CSP in insect defense.PLoS One11:e0154706. 10.1371/journal.pone.0154706
29
LiuG. X.XuanN.ChuD.XieH. Y.FanZ. X.BiY. P.et al (2014). Biotype expression and insecticide response of Bemisia tabaci chemosensory protein-1.Arch. Insect Biochem. Physiol.85137–151. 10.1002/arch.21148
30
LiuR.HeX.LehaneS.LehaneM.Hertz-FowlerC.BerrimanM.et al (2012). Expression of chemosensory proteins in the tsetse fly Glossina morsitans morsitans is related to female host-seeking behaviour.Insect Mol. Biol.2141–48. 10.1111/j.1365-2583.2011.01114.x
31
LuD.LiX.LiuX.ZhangQ. (2007). Identification and molecular cloning of putative odorant-binding proteins and chemosensory protein from the bethylid wasp, Scleroderma guani Xiao et Wu.J. Chem. Ecol.331359–1375. 10.1007/s10886-007-9310-5
32
MaC.CuiS.TianZ.ZhangY.ChenG.GaoX.et al (2019). OcomCSP12, a chemosensory protein expressed specifically by ovary, mediates reproduction in Ophraella communa (Coleoptera: Chrysomelidae).Front. Physiol.10:1290. 10.3389/fphys.2019.01290
33
MaleszkaJ.ForetS.SaintR.MaleszkaR. (2007). RNAi-induced phenotypes suggest a novel role for a chemosensory protein CSP5 in the development of embryonic integument in the honeybee (Apis mellifera).Dev. Genes Evol.217189–196. 10.1007/s00427-006-0127-y
34
MaleszkaR.StangeG. (1997). Molecular cloning, by a novel approach, of a cDNA encoding a putative olfactory protein in the labial palps of the moth Cactoblastis cactorum.Gene20239–43. 10.1016/S0378-1119(97)00448-4
35
MaoY. B.CaiW. J.WangJ. W.HongG. J.TaoX. Y.WangL. J.et al (2007). Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol.Nat. Biotechnol.251307–1313. 10.1038/nbt1352
36
MarcheseS.AngeliS.AndolfoA.ScaloniA.BrandazzaA.MazzaM.et al (2000). Soluble proteins from chemosensory organs of Eurycantha calcarata (Insects, Phasmatodea).Insect Biochem. Mol. Biol.301091–1098. 10.1016/S0965-1748(00)00084-9
37
McKenzieS. K.OxleyP. R.KronauerD. J. (2014). Comparative genomics and transcriptomics in ants provide new insights into the evolution and function of odorant binding and chemosensory proteins.BMC Genomics15:718. 10.1186/1471-2164-15-718
38
Nagnan-Le MeillourP.CainA. H.Jacquin-JolyE.FrancoisM. C.RamachandranS.MaidaR.et al (2000). Chemosensory proteins from the proboscis of Mamestra brassicae.Chem. Senses25541–553. 10.1093/chemse/25.5.541
39
PelosiP.CalvelloM.BanL. (2005). Diversity of odorant-binding proteins and chemosensory proteins in insects.Chem. Senses30(Suppl. 1)i291–i292. 10.1093/chemse/bjh229
40
PelosiP.IovinellaI.FelicioliA.DaniF. R. (2014). Soluble proteins of chemical communication: an overview across arthropods.Front. Physiol.5:320. 10.3389/fphys.2014.00320
41
PelosiP.IovinellaI.ZhuJ.WangG.DaniF. R. (2018). Beyond chemoreception: diverse tasks of soluble olfactory proteins in insects.Biol. Rev. Camb. Philos. Soc.93184–200. 10.1111/brv.12339
42
PelosiP.ZhouJ. J.BanL. P.CalvelloM. (2006). Soluble proteins in insect chemical communication.Cell Mol. Life Sci.631658–1676. 10.1007/s00018-005-5607-0
43
QiM.WeiS.WeiC. (2018). Identification of candidate olfactory genes in cicada Subpsaltria yangi by antennal transcriptome analysis.Comp. Biochem. Physiol. Part D Genomics Proteomics28122–133. 10.1016/j.cbd.2018.08.001
44
RaabeM. (1987). Insect reproduction: regulation of successive steps.Adv. Insect Physiol.1929–154. 10.1016/S0065-2806(08)60100-9
45
SunL.ZhouJ. J.GuS. H.XiaoH. J.GuoY. Y.LiuZ. W.et al (2015). Chemosensillum immunolocalization and ligand specificity of chemosensory proteins in the alfalfa plant bug Adelphocoris lineolatus (Goeze).Sci. Rep.5:8073. 10.1038/srep08073
46
TamuraK.StecherG.PetersonD.FilipskiA.KumarS. (2013). MEGA6: molecular evolutionary genetics analysis version 6.0.Mol. Biol. Evol.302725–2729. 10.1093/molbev/mst197
47
UpadhyayS. K.ChandrashekarK.ThakurN.VermaP. C.BorgioJ. F.SinghP. K.et al (2011). RNA interference for the control of whiteflies (Bemisia tabaci) by oral route.J. Biosci.36153–161. 10.1007/s12038-011-9009-1
48
VieiraF. G.RozasJ. (2011). Comparative genomics of the odorant-binding and chemosensory protein gene families across the Arthropoda: origin and evolutionary history of the chemosensory system.Genome Biol. Evol.3476–490. 10.1093/gbe/evr033
49
WanF. H.YangN. W. (2016). Invasion and management of agricultural alien insects in China.Annu. Rev. Entomol.6177–98. 10.1146/annurev-ento-010715-023916
50
WangR.LiF.ZhangW.ZhangX.QuC.TetreauG.et al (2017). Identification and expression profile analysis of odorant binding protein and chemosensory protein genes in Bemisia tabaci MED by head transcriptome.PLoS One12:e0171739. 10.1371/journal.pone.0171739
51
WangZ.YanH.YangY.WuY. (2010). Biotype and insecticide resistance status of the whitefly Bemisia tabaci from China.Pest Manag. Sci.661360–1366. 10.1002/ps.2023
52
WannerK. W.WillisL. G.TheilmannD. A.IsmanM. B.FengQ.PlettnerE. (2004). Analysis of the insect os-d-like gene family.J. Chem. Ecol.30889–911. 10.1023/b:joec.0000028457.51147.d4
53
WarisM. I.YounasA.AdeelM. M.DuanS. G.QuershiS. R.KaleemU. R. M.et al (2020a). The role of chemosensory protein 10 in the detection of behaviorally active compounds in brown planthopper, Nilaparvata lugens.Insect Sci.27531–544. 10.1111/1744-7917.12659
54
WarisM. I.YounasA.AmeenA.RasoolF.WangM. Q. (2020b). Expression profiles and biochemical analysis of chemosensory protein 3 from Nilaparvata lugens (Hemiptera: Delphacidae).J. Chem. Ecol.46363–377. 10.1007/s10886-020-01166-6
55
WarisM. I.YounasA.Ul QamarM. T.HaoL.AmeenA.AliS.et al (2018). Silencing of chemosensory protein gene NlugCSP8 by RNAi induces declining behavioral responses of Nilaparvata lugens.Front. Physiol.9:379. 10.3389/fphys.2018.00379
56
XieW.ChenC.YangZ.GuoL.YangX.WangD.et al (2017). Genome sequencing of the sweetpotato whitefly Bemisia tabaci MED/Q.GigaScience6:1. 10.1093/gigascience/gix018
57
XuY. L.HeP.ZhangL.FangS. Q.DongS. L.ZhangY. J.et al (2009). Large-scale identification of odorant-binding proteins and chemosensory proteins from expressed sequence tags in insects.BMC Genomics10:632. 10.1186/1471-2164-10-632
58
XueW.FanJ.ZhangY.XuQ.HanZ.SunJ.et al (2016). Identification and expression analysis of candidate odorant-binding protein and chemosensory protein genes by antennal transcriptome of Sitobion avenae.PLoS One11:e0161839. 10.1371/journal.pone.0161839
59
ZengY.YangY. T.WuQ. J.WangS. L.XieW.ZhangY. J. (2019). Genome-wide analysis of odorant-binding proteins and chemosensory proteins in the sweet potato whitefly, Bemisia tabaci.Insect Sci.26620–634. 10.1111/1744-7917.12576
60
ZhangY. N.YeZ. F.YangK.DongS. L. (2014). Antenna-predominant and male-biased CSP19 of Sesamia inferens is able to bind the female sex pheromones and host plant volatiles.Gene536279–286. 10.1016/j.gene.2013.12.011
61
ZhengH. X.XieW.WangS. L.WuQ. J.ZhouX. M.ZhangY. J. (2017). Dynamic monitoring (B versus Q) and further resistance status of Q-type Bemisia tabaci in China.Crop Prot.94115–122. 10.1016/j.cropro.2016.11.035
62
ZhuJ.IovinellaI.DaniF. R.LiuY. L.HuangL. Q.LiuY.et al (2016). Conserved chemosensory proteins in the proboscis and eyes of Lepidoptera.Int. J. Biol. Sci.111394–1404. 10.7150/ijbs.16517
Summary
Keywords
chemosensory proteins, Bemisia tabaci, RNA interference, expression profiles, reproduction
Citation
Zeng Y, Merchant A, Wu Q, Wang S, Kong L, Zhou X, Xie W and Zhang Y (2020) A Chemosensory Protein BtabCSP11 Mediates Reproduction in Bemisia tabaci. Front. Physiol. 11:709. doi: 10.3389/fphys.2020.00709
Received
13 February 2020
Accepted
29 May 2020
Published
30 June 2020
Volume
11 - 2020
Edited by
Bin Tang, Hangzhou Normal University, China
Reviewed by
Guohua Zhong, South China Agricultural University, China; Sergio Angeli, Free University of Bozen-Bolzano, Italy; Kai Lu, Fujian Agriculture and Forestry University, China
Updates
Copyright
© 2020 Zeng, Merchant, Wu, Wang, Kong, Zhou, Xie and Zhang.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Wen Xie, xiewen@caas.cnYoujun Zhang, zhangyoujun@caas.cn
This article was submitted to Invertebrate Physiology, a section of the journal Frontiers in Physiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.