Abstract
White adipose tissue (WAT) distribution and WAT mitochondrial function contribute to total body metabolic health throughout life. Nutritional interventions starting in the postweaning period may impact later life WAT health and function. We therefore assessed changes in mitochondrial density and function markers in WAT depots of young mice. Inguinal (ING), epididymal (EPI) and retroperitoneal (RP) WAT of 21, 42 and 98 days old C57BL/6j mice was collected. Mitochondrial density [citrate synthase (CS), mtDNA] and function [subunits of oxidative phosphorylation complexes (OXPHOS)] markers were analyzed, together with gene expression of browning markers (Ucp1, Cidea). mRNA of ING WAT of 21 and 98 old mice was sequenced to further investigate functional changes of the mitochondria and alterations in cell populations. CS levels decreased significantly over time in all depots. ING showed most pronounced changes, including significantly decreased levels of OXPHOS complex I, II, and III subunits and gene expression of Ucp1 (PN21-42 and PN42-98) and Cidea (PN42-98). White adipocyte markers were higher at PN98 in ING WAT. Analyses of RNA sequence data showed that the mitochondrial functional profile changed over time from “growth-supporting” mitochondria focused on ATP production (and dissipation), to more steady-state mitochondria with more diverse functions and higher biosynthesis. Mitochondrial density and energy metabolism markers declined in all three depots over time after weaning. This was most pronounced in ING WAT and associated with reduced browning markers, increased whitening and an altered metabolism. In particular the PN21-42 period may provide a time window to study mitochondrial adaptation and effects of nutritional exposures relevant for later life metabolic health.
Introduction
Obesity prevalence is high in adults and considerably increased nowadays in children and adolescents (). Childhood obesity increases the risk for early onset metabolic diseases, like type 2 diabetes mellitus (T2D) and cardiovascular disease (). An important link between obesity and metabolic diseases is the metabolic function of the white adipose tissue (WAT), i.e., WAT health ().
Mitochondrial density in adulthood appears to be strongly correlated to WAT health as shown by a reduced WAT mitochondrial density in obesity () and T2D (). Nutrition may regulate WAT function as feeding a high fat diet reduced WAT mitochondrial density (), a process that is already initiated after 5 days of western style diet (WSD) (), while caloric restriction and diets enriched in poly-unsaturated fatty acids increased WAT mitochondrial density, oxidative capacity and biogenesis (; ). Dependent on their location in the body, WAT depots differ in their impact on metabolic health (; ). Visceral WAT is located in the abdominal cavity and visceral WAT mass is inversely correlated to total body insulin sensitivity and as such considered a risk factor for development of the metabolic syndrome (; ). In contrast, subcutaneous WAT is located directly under the skin and is shown to have a higher oxidative capacity compared to the visceral depots in mice ().
Experimental evidence suggests that growth and distribution of WAT as well as mitochondrial density of WAT depots can be programmed by early life environmental factors. For example, maternal obesity, over-nutrition or undernutrition during pregnancy can all drive increased visceral adiposity and an adapted mitochondrial density in rodent offspring (; ; ; ). In addition, mild caloric restriction or a high fat diet exposure in the lactation period also programmed adult adiposity and metabolic health of pups (; ). Those studies show that suboptimal nutrient conditions in early life can have long-term metabolic consequences. Programming of the oxidative and storage capacity of WAT, which develops from the third trimester of gestation until adolescence (), may be an underlying mechanism.
The postnatal development of WAT includes differentiation from progenitor cells to fully developed adipocytes containing lipid droplets, a process starting before birth in subcutaneous depots and after birth in visceral depots (; ). After weaning WAT depots continue to grow and adipocytes increase in size (hypertrophy) and number (hyperplasia) in a depot specific manner (). Furthermore, WAT depots develop postnatally from a white phenotype at PN10 to a brown phenotype at PN20 where the majority of the adipocytes are multilocular and express UCP1, after which these cells disappear again and are replaced by unilocular adipocytes which only express UCP1 upon cold-induction (; ; ).
Many nutritional intervention studies, including postnatal programming studies, i.e., studies with a nutritional intervention in early life with the aim to improve adult metabolic health (; ; ; ), take the postweaning period (around PN21) as starting point. Comprehensive and extended comparison of postweaning changes of markers for mitochondrial function and WAT browning in different WAT depots is crucial for the interpretation of those studies. Therefore, we here investigate early life changes in markers for mitochondrial density, function and browning in the developing WAT depots with the aim to substantiate and extend, in terms of number of markers and WAT depots analyzed, available research. To this end we collected inguinal (ING), epididymal (EPI) and retroperitoneal (RP) WAT, of 21, 42, and 98 days old mice, housed under standardized experimental conditions (ambient temperature) and comprehensively measured markers of mitochondrial density, function and browning as well as the effect of a WSD on these markers. In addition, we newly examined changes within mitochondrial functional profile by analyzing transcription of all established mitochondrial proteins and categorize them to function.
Materials and Methods
Study Design
Mice were kept at the animal facility of Intravacc (Bilthoven, Netherlands) under a 12 h light – 12 h dark cycle (lights on at 06:00 h). Room temperature and humidity were kept at constant level (21 ± 2°C and 50 ± 5%, respectively). This housing temperature was chosen to adhere to the most common temperature used for animal experiments. C57BL/6jOlaHsd breeders were purchased from Harlan (Envigo since 2015, Horst, Netherlands), acclimatized for 2 weeks, time mated and fed a American Institute of Nutrition-93G synthetic diet (AIN93G) () during breeding, pregnancy and lactation. Within 2 days after birth, litters were culled to four males and two females and randomly assigned to a dam. At postnatal day 21 (PN21) female mice were killed, while male mice were weaned, housed in littermate-pairs and continued on AIN93G until PN42. From PN42 until sacrifice at PN98 mice were fed AIN93M () or WSD (containing 39 en% fat; diet composition in Table 1). Food and water were available ad libitum during the entire experimental period. A very limited amount of food was supplied the night before dissection to ensure that the animals were in a fasted state (approximately 8 h). Body weight and food intake were measured twice a week. At different time points (PN21, PN42, and PN98) mice were sacrificed to assess the development of WAT depots and the effect of the WSD challenge, resulting in the following experimental groups (i) PN21 (n = 8), (ii) PN42 (n = 8), (iii) PN98-AIN (n = 11), and (iv) PN98-WSD (n = 11; Figure 1A). At dissection mice were anesthetized (isoflurane/N2O/O2), terminated by bleeding (eye extraction) and ING, EPI, and RP WAT were collected, weighted, snap frozen and stored at -80°C.
Table 1
| Diet | AIN93GG | AIN93M | WSD | |
|---|---|---|---|---|
| Carbohydrates | (g/kg) | 629.5 | 720,7 | 499.5 |
| Dextrose | (g/kg) | – | 50 | 150 |
| Sucrose | (g/kg) | 100 | 100 | – |
| Starch | (g/kg) | 397.5 | 415.7 | 150 |
| Maltodextrin | (g/kg) | 132 | 155 | 199.5 |
| Proteins | (g/kg) | 203 | 141.8 | 203 |
| Casein | (g/kg) | 200 | 140 | 200 |
| Cystine | (g/kg) | 3.0 | 1.8 | 3.0 |
| Fat | (g/kg) | 70 | 40 | 200 |
| Soy oil | (g/kg) | 70 | 40 | 30 |
| Lard | (g/kg) | – | – | 169 |
| Cholesterol | (g/kg) | – | – | 1.0 |
| Fiber (Cellulose) | (g/kg) | 50 | 50 | 50 |
| Vitamin and mineral mix | (g/kg) | 47.5 | 47.5 | 47.5 |
| Energy % | ||||
| Carbohydrates | (en%) | 64 | 76 | 43 |
| Proteins | (en%) | 21 | 15 | 18 |
| Fat | (en%) | 16 | 9 | 39 |
Diet composition.
FIGURE 1
Sample Homogenization
The EPI, ING, and RP WAT depots were homogenized with a Cellcrusher (Cellcrusher, Cork, Ireland) and aliquots of the resulting homogenized powder where made to enable separate analyses. EPI and RP WAT at PN21 were too small to make aliquots and were therefore only used for RNA extractions and enzyme activity measurements, respectively. In addition, RP WAT of PN42 was too small to analyze mitochondrial DNA levels.
Gene Expression
RNA of EPI, ING and RP WAT was isolated using Trizol (Thermo Fisher Scientific, Landsmeer, Netherlands) followed by purification with a RNeasy Mini Kit (Qiagen Benelux b.v., Zwijndrecht, Netherlands) including a DNase treatment with a RNase-free DNase Set (Qiagen Benelux b.v.) as previously described (). RNA quantity and chemical purity were assessed with the Nanodrop 2000 (Thermo Fisher Scienctific) and integrity with the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, United States). iScriptcDNA synthesis kit (Bio-Rad, Veenendaal, Netherlands) was used according to manufacturer instructions. 6.25 ng cDNA was used as input for each Q-PCR reaction. SYBR Select Master Mix (Life Technologies Europe, Bleiswijk, Netherlands) was used according to manufacturer instructions and qPCR was performed with a QuantStudio 6 Flex Real-Time PCR System (Life Technologies Europe). mRNA expression of cell death-inducing DNA fragmentation factor, alpha subunit-like effector A (Cidea), Leptin (Lep), mesoderm specific transcript (Mest, also known as Peg1), delta-like 1 homolog (Dlk1, better known as Pref1, which will be used here) and uncoupling protein 1 (Ucp1) were analyzed relative to mean expression of two reference genes, hypoxanthine guanine phosphoribosyl transferase (Hprt) and zinc finger, AN1-type domain 6 (Zfand6). For a complete list of primers used see Table 2. Normalization of qPCR data was performed using the qbase+ (Biogazelle, Genth, Belgium) based on the method of relative normalization as described (; ). Reference genes Hprt1 and Zfand6 were selected based on transcriptome data and stability checked by Q-PCR analyses. Primers for Ucp1 were purchased from Biorad, all other primers from Biolegio (Biolegio, Nijmegen, Netherlands).
Table 2
| Gene name | NCBI reference number | Forward primer (5′ – 3′) | Reverse primer (5′ – 3′) |
|---|---|---|---|
| Genes of interest: | |||
| Cidea | NM_007702.2 | aggccgtgttaaggaatctg | cccagtactcggagcatgta |
| Lep | NM_008493_3 | aggatgacaccaaaaccctcat | agtccaagccagtgaccctct |
| Mest | NM_008590.1 | tcagtgacaagccgagacca | gttgattctgcggttctggag |
| Pref1 | NM_010052.5 | tgcgaggctgacaatgtctg | atgcactgccatggttcctt |
| Ucp1 | assay ID qMmuCID0005832 | ||
| Reference genes: | |||
| Hprt | NM_013556.2 | ggacctctcgaagtgttggat | ccaacaacaaacttgtctggaa |
| Zfand6 | NM_022985.6 | tgggacttactgggtttgaa | ttctcagcagcatcagcttt |
| DNA primers: | |||
| mt-Nd1 | NC_005089.1 | accaatacgccctttaacaac | aatgggtgtggtattggtagg |
| Lpl | NM_008509 | tcctgatgacgctgattttg | atgtcaacatgccctactgg |
Primer sequences.
Enzyme Activity
Citrate synthase (CS) and hydroxyacyl-Coenzyme A dehydrogenase (HADH) activities were measured as described (; ).
OXPHOS and UCP1 Protein Levels
Protein levels of five subunits (NDUFB8, SDHB, UQCRC2, MTCOI, ATP5A1) representing the five oxidative phosphorylation (OXPHOS) complexes (I–V, respectively) were measured with western blot (; ). Briefly, 15 μg of total protein per sample was used for SDS-PAGE, transfer to a PVDF membrane was done using the TransBlot Turbo (Biorad). Blots were blocked with 5% Protifar (Nutricia, Zoetermeer, Netherlands), incubated with Mito-Profile Total OXPHOS rodent western blot antibody cocktail (Abcam, Cambridge, United Kingdom) as primary antibody and ECL anti mouse IgG (Thermo Fisher Scienctific) as a secondary antibody. OXPHOS protein levels, detected with Supersignal West Dura (Thermo Fisher Sceintific), were related to total protein levels as analyzed by Coomassie brilliant blue staining. Protein levels were detected with the Chemidoc XRS and analyzed by Quantity One (Biorad). The same procedure was used for detection of UCP1 protein levels, except that 5% BSA was used as blocking agent, rabbit anti mouse UCP1 (Abcam, Cambridge, United Kingdom) was used as primary antibody, goat anti rabbit IgG (Santa Cruz, Dallas, United States) as secondary antibody and Supersignal West Femto (Thermo Fisher Scientific) was used for signal detection. A representative Western blot stained for the OXPHOS and for UCP1 proteins and the corresponding Coomassie brilliant blue stained blots are shown in Supplementary Figures 3, 4, respectively.
Mitochondrial DNA Density
Mitochondrial copy number was assessed by the ratio (ΔCt) between nuclear DNA (abundance of lipoprotein lipase (Lpl) DNA) and mitochondrial DNA (abundance of mitochondrial gene NADH dehydrogenase 1 (mt-Nd1) DNA) (). Briefly, total DNA was isolated with the QIAamp DNA micro kit (Qiagen Benelux), following instructions of the manufacturer. DNA quantity was determined with Quant-iT Picogreen dsDNA assay kit (Thermo Fisher Scientific). 10 ng input DNA was used for each qPCR reaction. Primers sequences are shown in Table 2.
mRNA Sequencing
RNA samples of ING depots from PN21 and PN98 (n = 4 per time point) were used for mRNA sequencing analysis (NXT-Dx, Gent, Belgium). After RNA quantification (Rediplate 96 Ribogreen RNA Quantitation kit, Life Technologies), RNA libraries were prepared (NEBNext Ultra Directional RNA library Prep Kit for Illumina, New England Biolabs INC., Ipswich, United Kingdom), intact poly(A)+ RNA was isolated (NEBNext Poly(A) mRNA Magnetic isolation Module, New England Biolabs INC., Ipswich, United Kingdom) and cDNA libraries were sequenced (paired end, 100 base pairs) on an Illumina HiSeq sequencer (Illumina Netherlands, Eindhoven, Netherlands). FASTQ sequences were generated using the Illumina Casava pipeline 1.8.2. Quality of the data was assessed using the Illumina Chasitity filter and quality of the reads using the FASTQC quality control tool version 0.10.0. Subsequently, data were mapped on the mouse reference genome mm10 using STAR Aligner 2.3.0 and analyzed with Cufflinks v2.1.1 on Gencode annotation v15. mRNA sequence data have been deposited at the NCBI Gene expression omnibus (GSE116313).
Data Analyses mRNA Sequence Data
Data analysis included contrast analysis (R package Limma) between PN21 and PN98, omitting transcripts whit a FPKM (fragments per kilobase million) of zero in at least one of the samples and including transcripts with an average FPKM > 2 at PN21 or PN98. Principal Component Analysis (PCA) was performed to visualize the samples and results are reported in Supplementary Figure 1. Transcripts with a p-value below 0.05 were used for Ingenuity Pathway Analysis (Qiagen Bioinformatics, Aarhus, Denmark) and targeted analysis as described below.
The data set was examined for changes in brown and white (pre)adipocyte markers derived from to get insight in the change in cell population in ING WAT between PN21 and 98.
To further explore changes in mitochondrial function, a list of genes encoding proteins with strong support of mitochondrial localization was derived from Mitocarta (Mouse MitoCarta 2.0, Broad institute), checked for their regulation in the data set, annotated with Nextprot (SIB Swiss institute for bioinformatics) and sorted per function category. When more than one transcript per gene was present in the data set, the transcript with the lowest p-value was used. Some of the genes are listed as non-mitochondrial (11 of 327) in the results table, because these are annotated in Nextprot having a ribosomal, extracellular matrix or cell membrane localization rather than a mitochondrial localization.
Next to this, a list of genes known to be involved in mitophagy was examined in the same data set, to get a better understanding of underlying mechanisms for WAT whitening.
Statistical Analysis
SPSS 19.0 (SPSS Benelux, Gorinchem, Netherlands) was used for statistical analyses. Gaussian distribution was tested with Levene’s test for equality of error variances in all parameters. Differences over time (per depot) were analyzed using Univariate ANOVA. Depot differences over time were analyzed using a two-way ANOVA (Brown-Forsyte) with time and depot as factors. A t-test was used to analyze the effect of the WSD. Data that did not show a Gaussian distribution was analyzed by Kruskall-Wallis for time differences and Mann-Whitney for the adult diet effect. qPCR data is presented as mean relative expression (scaled to average expression) + SEM and all other data is displayed as mean + SEM. Differences were considered significant at p < 0.05 and tendency was reported when 0.05 < p < 0.1. Correlations were analyzed with Pearson’s test.
Results
Body Weight, WAT Weight and Markers of Adiposity
Body weight increased significantly between weaning (PN21) and young adulthood (PN98) (p < 0.001) (Figure 1B), as did the weight of ING, EPI and RP WAT (p < 0.01; Figure 1C–E). In accordance with increased WAT weight, gene expression levels of adiposity (Lep) and adipocyte expansion (Mest) markers increased over time in EPI WAT (p < 0.05 for Lep and p < 0.001 for Mest) and RP WAT (p = 0.06 for Lep and p < 0.05 for Mest), but not ING WAT (Figure 1F–K). Mest and Lep expression levels were increased in ING WAT upon WSD exposure (p < 0.001 for both parameters; Figure 1F,I). Lep expression levels were also moderately increased in EPI and RP WAT upon WSD (p < 0.05 for EPI and p = 0.08 for RP WAT; Figure 1G,H), whereas Mest expression levels were unaffected upon WSD in EPI and RP WAT (Figure 1J,K).
Pref1 expression levels, a pre-adipocyte number marker, decreased in all depots over time (p < 0.001) and most pronounced from PN21 to 42 (Figure 1L–N). In contrast, Pref1 expression levels were in EPI and RP WAT not affected by the WSD, but levels were slightly elevated in ING WAT (p < 0.01).
Markers of Mitochondrial Density
Mitochondrial density measured by citrate synthase (CS) levels, assayed as activity, decreased over time in all WAT depots (p < 0.01; Figure 2A–C). Between PN21 and PN42 CS levels decreased substantially (-56%) in ING WAT (p < 0.05). CS levels were not affected by the WSD in any depot (Figure 2A–C). Activity-based levels of hydroxyacyl-Coenzyme A dehydrogenase (HADH), a mitochondrial enzyme involved in β-oxidation, decreased over time in ING and EPI WAT (p < 0.001; Figure 2G,H), but not in RP WAT (Figure 2I). However, HADH activity tended to decrease in RP WAT upon WSD exposure (p = 0.07; Figure 2G–I). When mitochondrial density was measured as mtDNA copy number no significant decrease over time or upon WSD was found (Figure 2D–F).
FIGURE 2
Markers of Mitochondrial Oxidative Capacity
Mitochondrial oxidative capacity, measured by protein levels of five subunits representing the five oxidative phosphorylation (OXPHOS) complexes, decreased in ING WAT over time for NDUFB8 (p < 0.01; Figure 3A), SDHB and UQCRC2 (p < 0.01; Figure 3D,G) and upon WSD for UQCRC2 (Figure 3G) and MTCOI (Figure 3J). ATP5A protein expression decreased over time in EPI WAT (p < 0.05; Figure 3N) but was not affected in the ING WAT (Figure 3M). Other complexes of EPI WAT and all complexes in RP WAT remained stable over time and were not affected by the WSD (Figure 3).
FIGURE 3
Markers of WAT Browning
Gene expression levels of the uncoupling protein Ucp1, as marker for browning of WAT, was relatively high in ING WAT at PN21 and decreased substantial over time (p < 0.001; Figure 4A). Ucp1 expression levels were low in visceral depots, but also decreased over time in EPI WAT (p < 0.01; Figure 4B,C). Cidea gene expression levels were substantially higher in ING WAT compared to visceral depots (Figure 4D,E), but in contrast to Ucp1 remained stable in ING WAT between PN21 and 42, after which Cidea levels declined from PN42 to 98 (p < 0.01). UCP1 protein levels tended to decline from PN21 to 42 and 98 (p = 0.09; Figure 4G) and were low and not changing over time in the visceral depots (Figure 4H,I). Upon WSD exposure, Ucp1 and Cidea gene expression levels decreased in ING WAT (p < 0.05), but remained unaffected in the visceral EPI and RP WAT depots. UCP1 protein levels tended to decline upon the WSD exposure in ING WAT (p = 0.1), was not affected by the WSD in the EPI WAT but increased upon the WSD in RP WAT (p < 0.01). Ucp1 and Cidea expression levels did not change over time in RP WAT (Figure 4C,F). It should be noted that UCP1 protein levels were very heterogeneous at PN98, showing some animals with much higher levels than on average.
FIGURE 4
Depot Differences
ING WAT had overall lower expression of adiposity markers (Lep, Mest; p < 0.001) and higher levels of mitochondrial (CS and HADH activity and OXPHOS subunits I – IV; p < 0.001) and browning markers (Ucp1 and Cidea gene expression and UCP1 protein levels; p < 0.001) compared to both EPI and RP WAT. Especially at PN21 and 42 CS and HADH levels were higher in ING compared to EPI and RP WAT (p < 0.01) and at PN42 levels of OXPHOS complexes I–IV were also higher in ING compared to RP and EPI WAT (p < 0.01). Subsequent decline in CS, HADH and OXPHOS complexes I–IV levels was steeper in ING WAT compared to the visceral depots and resulted in similar CS, HADH and OXPHOS subunit II levels in ING WAT and RP WAT and HADH and subunit II levels being similar in ING WAT and EPI WAT at PN98. Ucp1 and Cidea gene expression levels were also significant higher in ING compared to EPI and RP WAT at PN21 and 42 (p < 0.01) and had a steeper decline over time resulting in comparable Ucp1 gene expression levels in ING and RP WAT at PN98. OXPHOS complex I-IV from the electron transport system, which drives ATP synthesis by OXPHOS complex V, the final step that is bypassed by UCP1 mediated uncoupling. Remarkably, unlike complex I–IV, levels of complex V (represented by ATP5A) were similar between depots.
Pathway Analysis of mRNA Sequence Data
To better understand the changes in mitochondrial density and function markers in ING WAT over time, mRNA of ING WAT at PN21 and 98 was sequenced (n = 4 per time point). 91969 transcripts were found, 23193 of these transcripts had a FPKM value >0 for all samples and an average FPKM > 2 at PN21 or 98. For pathway analysis 5040 transcripts with a p-value <0.05 were used, resulting in a list of pathways which were significant regulated over time (Table 3). Most differentially regulated pathways include those involved in regulation of cell proliferation and growth and pathways involved in hormonal regulation and immune response. Protein synthesis was down regulated over time and pathways involved in the FA metabolism were up regulated over time. Overlap between the regulated pathways was plotted as a network map, showing much overlap between pathways, including those involved in the regulation of cell proliferation and growth as well as pathways involved in hormonal regulation and immune response. Two pathways were less connected to the central network: “mitochondrial dysfunction” and “lipid antigen presentation by CD1” (Supplementary Figure 2). The “mitochondrial dysfunction” pathway contained genes representing subunits of the oxidative phosphorylation and other genes involved in the function of mitochondria, and its IPA name follows the general idea that downregulation of the genes contained in this pathway is associated with dysfunctional mitochondria, like in T2D, Alzheimer’s or Parkinson’s disease. Although ingenuity pathway analysis did not indicate a direction for the change in the mitochondrial dysfunction pathway, 35 of the 44 regulated genes in this pathway were down regulated over time, what may indicate that mitochondrial function is reduced at PN98 compared to PN21 in ING WAT (Supplementary Table 1).
Table 3
| Canonical Pathways | -log(p-value) | Ratio | z-score |
|---|---|---|---|
| Top 10 down regulated pathways | |||
| EIF2 signaling | 12.10 | 0.34 | -3.833 |
| Estrogen-mediated S-phase entry | 5.96 | 0.58 | -3.051 |
| STAT3 pathway | 5.58 | 0.37 | -0.577 |
| Cyclins and cell cycle regulation | 4.96 | 0.35 | -2.524 |
| Regulation of eIF4 and p70S6K signaling | 4.13 | 0.27 | -1.155 |
| mTOR signaling | 4.02 | 0.25 | -0.408 |
| Acute phase response signaling | 4.00 | 0.26 | -1.333 |
| Phospholipase C signaling | 3.78 | 0.24 | -2.359 |
| NF-κB activation by viruses | 3.68 | 0.30 | -2.353 |
| 14-3-3-mediated signaling | 3.61 | 0.27 | -0.378 |
| Top 10 up regulated pathways | |||
| Cell cycle: G1/S checkpoint regulation | 5.72 | 0.39 | 1.706 |
| Aryl hydrocarbon receptor signaling | 5.45 | 0.30 | 2.000 |
| Protein kinase A signaling | 4.71 | 0.23 | 1.732 |
| Cell Cycle: G2/M DNA damage checkpoint regulation | 4.44 | 0.39 | 1.414 |
| Androgen signaling | 4.34 | 0.30 | 0.535 |
| Sumoylation pathway | 4.02 | 0.30 | 1.043 |
| PPARα/RXRα activation | 3.75 | 0.25 | 2.874 |
| LXR/RXR activation | 3.20 | 0.26 | 0.557 |
| PPAR signaling | 2.74 | 0.27 | 2.858 |
| Apoptosis signaling | 2.67 | 0.27 | 0.816 |
| Top 10 pathways without available activity pattern∗ | |||
| Cell cycle control of chromosomal replication | 8.08 | 0.55 | NaN |
| RAR activation | 6.75 | 0.30 | NaN |
| Estrogen receptor signaling | 6.15 | 0.32 | NaN |
| Adipogenesis pathway | 6.00 | 0.31 | NaN |
| Glucocorticoid receptor signaling | 5.47 | 0.25 | NaN |
| Mitochondrial dysfunction | 3.87 | 0.26 | NaN |
| Lipid antigen presentation by CD1 | 3.85 | 0.46 | NaN |
| T cell receptor signaling | 3.72 | 0.28 | NaN |
| TR/RXR activation | 3.46 | 0.29 | NaN |
| Assembly of RNA polymerase II complex | 3.24 | 0.34 | NaN |
List of significant regulated pathways at PN98 as analyzed by ingenuity pathway analysis (IPA).
Expression of transcripts determined with mRNA sequencing and data analyzed with ingenuity Pathway Analysis (Qiagen Bioinformatics, Aarhus, Denmark). Difference between postnatal day 21 over 98.∗No information on activity pattern was available in IPA and no Z-score calculated as a consequence.
Targeted Analysis of mRNA Sequence Data
A list of brown and white preadipocyte and adipocyte markers was extracted from literature (
A list of genes of which mitochondrial localization is strongly supported (Mitocarta, 1158 genes) were checked for expression in the data set to further explore functional changes of the mitochondria over time. 327 genes of this list were identified in the data set, of which 231 gene were down regulated, 88 up regulated and 8 genes had discrepancy in regulation between different transcripts. Genes involved in energy metabolism and protein syntheses were down regulated over time, including oxidative phosphorylation, citric acid (TCA) cycle, β-oxidation, import, transport and translation. The up regulated genes showed more diversity in function, including glycolytic metabolism, lipid synthesis, biosynthesis and mitophagy. The list with genes categorized to function is shown in Supplementary Tables 3, 4. A summary of these findings is presented in Figure 5.
FIGURE 5

Functional categorization of regulated genes (PN21 over 98) with a strong support for mitochondrial localization. Expression of transcripts analyzed with mRNA sequence, of the transcripts with p < 0.05 genes encoding proteins with strong support of mitochondrial localization (Mouse MitoCarta 2.0, Broad institute) were selected and functional categorized with Nextprot (SIB Swiss institute for bioinformatics). The full list of genes with functional categorization is shown in Supplementary Tables 3, 4.
Established mitophagy/autophagy markers (
Table 4
| Gene name | ENSBL ID | FC | p-value | Adjusted p-value |
|---|---|---|---|---|
| Map1lc3a (Lc3) | ENSMUSG00000027602 | 1.90 | 0.020 | 0.169 |
| Sqstm1 (p62) | ENSMUSG00000015837 | 1.80 | 0.004 | 0.099 |
| Ulk1 | ENSMUSG00000029512 | 1.22 | 0.253 | 0.466 |
| Ulk2 | ENSMUSG00000004798 | 1.39 | 0.028 | 0.190 |
| Atg7 | ENSMUSG00000030314 | 1.24 | 0.100 | 0.300 |
| Pink1 | ENSMUSG00000028756 | 2.66 | <0.001 | 0.024 |
| Prkn (Parkin) | ENSMUSG00000023826 | Not detected | ||
| Bnip3l | ENSMUSG00000022051 | Mean count at PN21 < 2 | ||
| Bnip3 | ENSMUSG00000078566 | 2.70 | <0.001 | 0.026 |
| Fundc1 | ENSMUSG00000025040 | Mean count at PN21 < 2 | ||
Regulation of mitophagy/autophagy markers in ING WAT from PN21 to 98 as measured with RNA sequencing.
Expression reported as fold changes between postnatal day 21 over 98. Significant differences are bold.
Correlations
There were many correlations between mitochondrial density and function markers and WAT weight (Table 5). Specifically, the inverse correlation between CS and HADH levels and weight of the corresponding depot was consistently strong in all depots. ING WAT weight was also inversely correlated to levels of the electron transport system complexes (OXPHOS complexes I–IV). In contrast, no correlation was found between ING WAT weight and the level of OXPHOS complex V (ATP5A; Table 5). RP WAT demonstrated opposite findings: the electron transport system complexes did not correlate with WAT weight, but complex V (ATP5A) showed a mild, inverse correlation with WAT weight. Lep gene expression was correlated to WAT weight for each of the depots, but this correlation was stronger in the visceral depots compared to ING WAT. Ucp1 expression, a key marker for browning of WAT, in ING WAT was correlated to mitochondrial density (CS and mtDNA, Table 5) and function markers (OXPHOS complexes I–IV), but not in RP WAT. In EPI WAT Ucp1 expression was only to some extent correlated to CS and HADH levels. Ucp1 expression in ING WAT was not correlated to complex V levels.
Table 5
| ING WAT | EPI WAT | RP WAT | ||||
|---|---|---|---|---|---|---|
| r | p | r | p | r | p | |
| Correlations with WAT weight | ||||||
| CS activity | -0.738 | <0.001 | -0.579 | <0.001 | -0.788 | <0.001 |
| HADH activity | -0.759 | <0.001 | -0.615 | <0.001 | -0.725 | <0.001 |
| mtDNA | -0.444 | <0.05 | -0.335 | 0.076 | -0.607 | <0.01 |
| NDUFB8 | -0.681 | <0.001 | -0.484 | <0.01 | -0.02 | n.s. |
| SDHB | -0.695 | <0.001 | -0.451 | <0.05 | -0.01 | n.s. |
| UQCRC2 | -0.734 | <0.001 | -0.687 | <0.001 | -0.04 | n.s. |
| MTCOI | -0.585 | <0.001 | -0.150 | n.s. | -0.098 | n.s. |
| ATP5A | -0.091 | n.s. | -0.571 | <0.001 | -0.478 | <0.05 |
| Lep | 0.558 | <0.001 | 0.768 | <0.001 | 0.758 | <0.001 |
| Correlations with Ucp1 | ||||||
| CS activity | 0.664 | <0.001 | 0.393 | <0.05 | 0.049 | n.s. |
| HADH activity | 0.696 | <0.001 | 0.490 | <0.01 | -0.048 | n.s. |
| mtDNA | 0.473 | <0.01 | 0.049 | n.s. | -0.136 | n.s. |
| NDUFB8 | 0.583 | <0.001 | 0.155 | n.s. | 0.197 | n.s. |
| SDHB | 0.582 | <0.001 | 0.113 | n.s. | -0.306 | n.s. |
| UQCRC2 | 0.599 | <0.001 | 0.287 | n.s. | -0.182 | n.s. |
| MTCOI | 0.511 | <0.001 | 0.031 | n.s. | -0.154 | n.s. |
| ATP5A | 0.126 | n.s. | 0.221 | n.s. | -0.221 | n.s. |
| Lep | -0.402 | <0.05 | -0.118 | n.s. | -0.023 | n.s. |
Correlations between WAT weight v. Ucp1 gene expression and mitochondrial function markers, Lep gene expression.
Discussion
In this study, we show clear changes in markers for mitochondrial density, mitochondrial function and browning in ING, EPI, and RP WAT depots of C57BL/6j mice after weaning up to young adulthood. We show that an increase in WAT depot mass and elevated levels of adiposity markers is associated with a decline in mitochondrial density over time in all depots. This decline was depot specific, being most pronounced in ING WAT with the steepest drop from PN21 to 42 and was accelerated by the WSD challenge. RNA sequence data from the ING depot showed that the decline in mitochondrial density was accompanied by a transfer from active, ATP producing mitochondria with a clear uncoupling potential toward mitochondria with a more diverse metabolic function and a higher biosynthesis. The RNA sequence data also showed that ING WAT developed from a “browner” toward a “whiter” phenotype with increased coupled mitochondria. These data also show that this is accompanied by an increased mRNA expression of mitophagy markers.
The present study aimed to comprehensively compare postweaning changes of markers for mitochondrial function and WAT browning in three different WAT depots. There is evidence from one other study showing decreasing mitochondrial enzyme activity in human subcutaneous WAT from the postnatal period to adulthood (
The declining mitochondrial density and function markers from weaning to young adulthood in ING WAT was accompanied by a diminished gene expression of the WAT browning markers Ucp1 and Cidea. UCP1 proteins levels tended to decrease accordingly, although statistical significance was not reached for the older AIN93 animals. Subcutaneous depots are more prone to WAT browning than visceral depots and have a higher abundancy of adipocytes with a brown-like phenotype, that can be activated upon cold exposure (
Recent publications revealed that the whitening of WAT is controlled by autophagy induced mitochondrial clearance (mitophagy), indicated by the activation of mitophagy during the beige to white transition in cultured adipocytes following β3-AR agonist withdrawal and the impaired whitening when autophagy is deleted in knock-out mouse models (
Our data on mitochondrial metabolic pathways show that mitochondria develop from organelles with a high expression of pathways directed at energy production (and dissipation), as in brown adipocytes (
The changes in the functionality of the mitochondria in the WAT depots and the remodeling of these depots in early life may have an impact for intervention studies starting in early life, as the effect of the intervention may be very dependent on the starting point of the intervention. In line with the developmental origins of health and disease theory (
Conclusion
The present study showed a decline in mitochondrial density and oxidative capacity markers in WAT depots of young C57Bl/6j mice over time while adipose tissue mass increased in size. The decline is more explicit in ING WAT compared to the visceral depots and is accompanied by an evolution from a browner, energy dissipating, to a whiter, biosynthetic, adipose tissue phenotype. These developmental changes may provide an opportunity to program a healthy WAT mitochondrial phenotype by nutritional interventions during the weaning period.
Statements
Ethics statement
All animal procedures were in accordance with the principles of good laboratory animal care following the EU directive for the protection of animals used for scientific purposes and approved by an external, independent Animal Experimental Committee (DEC consult, Soest, Netherlands).
Author contributions
AK, EE, and KvL conducted the experiments. AK and JK analyzed the data and drafted the manuscript. AK, AO, and JK interpreted the results. AK prepared the figures. All authors contributed to the design of the study, edited and revised the manuscript, and approved the final version of the manuscript.
Funding
This work was funded by the Danone Nutricia Research.
Acknowledgments
We thank Jan Polman for help in carrying out the data analyses of the mRNA sequence results and Joris Hoeks and Gert Schaart (Maastricht University) for sharing their UCP1 western blot protocol.
Conflict of interest
AK, EE, AO, KvL, and EvdB are employees of the Danone Nutricia Research. The remaining author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphys.2019.00836/full#supplementary-material
References
1
Altshuler-KeylinS.ShinodaK.HasegawaY.IkedaK.HongH.KangQ.et al (2016). Beige adipocyte maintenance is regulated by autophagy-induced mitochondrial clearance.Cell Metab.24402–419. 10.1016/j.cmet.2016.08.002
2
BaarsA.OostingA.EngelsE.KeglerD.KoddeA.SchipperL.et al (2016). Milk fat globule membrane coating of large lipid droplets in the diet of young mice prevents body fat accumulation in adulthood.Br. J. Nutr.1151930–1937. 10.1017/S0007114516001082
3
BirnbacherL.MaurerS.ScheidtK.HerzenJ.PfeifferF.FrommeT. (2018). Electron density of adipose tissues determined by phase-contrast computed tomography provides a measure for mitochondrial density and fat content.Front. Physiol.9:707. 10.3389/fphys.2018.00707
4
BjorndalB.BurriL.StaalesenV.SkorveJ.BergeR. K. (2011). Different adipose depots: their role in the development of metabolic syndrome and mitochondrial response to hypolipidemic agents.J. Obes.2011:490650. 10.1155/2011/490650
5
BoeufS.KlingensporM.Van HalN. L.SchneiderT.KeijerJ.KlausS. (2001). Differential gene expression in white and brown preadipocytes.Physiol. Genomics715–25.
6
BouwmanL. M. S.Fernandez-CallejaJ. M. S.SwartsH. J. M.van der SteltI.OostingA.KeijerJ.et al (2018). No adverse programming by post-weaning dietary fructose of body weight, adiposity, glucose tolerance, or metabolic flexibility.Mol. Nutr. Food Res.62:1700315. 10.1002/mnfr.201700315
7
BruceK. D.CagampangF. R.ArgentonM.ZhangJ.EthirajanP. L.BurdgeG. C.et al (2009). Maternal high-fat feeding primes steatohepatitis in adult mice offspring, involving mitochondrial dysfunction and altered lipogenesis gene expression.Hepatology501796–1808. 10.1002/hep.23205
8
Chabowska-KitaA.TrabczynskaA.KorytkoA.KaczmarekM. M.KozakL. P. (2015). Low ambient temperature during early postnatal development fails to cause a permanent induction of brown adipocytes.FASEB J.293238–3252. 10.1096/fj.15-271395
9
ChooH. J.KimJ. H.KwonO. B.LeeC. S.MunJ. Y.HanS. S.et al (2006). Mitochondria are impaired in the adipocytes of type 2 diabetic mice.Diabetologia49784–791. 10.1007/s00125-006-0170-2
10
ClaycombeK. J.Vomhof-DeKreyE. E.GarciaR.JohnsonW. T.UthusE.RoemmichJ. N. (2016). Decreased beige adipocyte number and mitochondrial respiration coincide with increased histone methyl transferase (G9a) and reduced FGF21 gene expression in Sprague-Dawley rats fed prenatal low protein and postnatal high-fat diets.J. Nutr. Biochem.31113–121. 10.1016/j.jnutbio.2016.01.008
11
DerousD.KelderT.van SchothorstE. M.van ErkM.VoigtA.KlausS.et al (2015). Network-based integration of molecular and physiological data elucidates regulatory mechanisms underlying adaptation to high-fat diet.Genes Nutr.10:470. 10.1007/s12263-015-0470-6
12
DeveaudC.BeauvoitB.SalinB.SchaefferJ.RigouletM. (2004). Regional differences in oxidative capacity of rat white adipose tissue are linked to the mitochondrial content of mature adipocytes.Mol. Cell Biochem.267157–166.
13
DiGirolamoM.FineJ. B.TagraK.RossmanithR. (1998). Qualitative regional differences in adipose tissue growth and cellularity in male Wistar rats fed ad libitum.Am. J. Physiol.274(5 Pt 2)R1460–R1467. 10.1152/ajpregu.1998.274.5.R1460
14
DingW. X.YinX. M. (2012). Mitophagy: mechanisms, pathophysiological roles, and analysis.Biol. Chem.393547–564. 10.1515/hsz-2012-0119
15
Fernandez-CallejaJ. M. S.BouwmanL. M. S.SwartsH. J. M.OostingA.KeijerJ.van SchothorstE. M. (2018). Direct and long-term metabolic consequences of lowly vs. highly-digestible starch in the early post-weaning diet of mice.Nutrients10:E1788. 10.3390/nu10111788
16
FlachsP.HorakovaO.BraunerP.RossmeislM.PecinaP.Franssen-van HalN.et al (2005). Polyunsaturated fatty acids of marine origin upregulate mitochondrial biogenesis and induce beta-oxidation in white fat.Diabetologia482365–2375. 10.1007/s00125-005-1944-7
17
FornerF.KumarC.LuberC. A.FrommeT.KlingensporM.MannM. (2009). Proteome differences between brown and white fat mitochondria reveal specialized metabolic functions.Cell Metab.10324–335. 10.1016/j.cmet.2009.08.014
18
GestaS.TsengY. H.KahnC. R. (2007). Developmental origin of fat: tracking obesity to its source.Cell131242–256. 10.1016/j.cell.2007.10.004
19
GluckmanP. D.HansonM. A. (2004). The developmental origins of the metabolic syndrome.Trends Endocrinol. Metab.15183–187.
20
HalesC. N.BarkerD. J. (2001). The thrifty phenotype hypothesis.Br. Med. Bull.605–20.
21
HammarstedtA.GrahamT. E.KahnB. B. (2012). Adipose tissue dysregulation and reduced insulin sensitivity in non-obese individuals with enlarged abdominal adipose cells.Diabetol. Metab. Syndr.4:42. 10.1186/1758-5996-4-42
22
HanJ.LeeJ. E.JinJ.LimJ. S.OhN.KimK.et al (2011). The spatiotemporal development of adipose tissue.Development1385027–5037. 10.1242/dev.067686
23
HansonM. A.GluckmanP. D. (2014). Early developmental conditioning of later health and disease: physiology or pathophysiology?Physiol. Rev.941027–1076. 10.1152/physrev.00029.2013
24
HellemansJ.MortierG.De PaepeA.SpelemanF.VandesompeleJ. (2007). qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data.Genome Biol.8:R19. 10.1186/gb-2007-8-2-r19
25
JousseC.MuranishiY.ParryL.MontaurierC.EvenP.LaunayJ. M.et al (2014). Perinatal protein malnutrition affects mitochondrial function in adult and results in a resistance to high fat diet-induced obesity.PLoS One9:e104896. 10.1371/journal.pone.0104896
26
KaamanM.SparksL. M.van HarmelenV.SmithS. R.SjolinE.DahlmanI.et al (2007). Strong association between mitochondrial DNA copy number and lipogenesis in human white adipose tissue.Diabetologia502526–2533. 10.1007/s00125-007-0818-6
27
KoddeA.van der BeekE. M.PhielixE.EngelsE.SchipperL.OostingA. (2017). Supramolecular structure of dietary fat in early life modulates expression of markers for mitochondrial content and capacity in adipose tissue of adult mice.Nutr. Metab.14:37. 10.1186/s12986-017-0191-5
28
LasarD.JuliusA.FrommeT.KlingensporM. (2013). Browning attenuates murine white adipose tissue expansion during postnatal development.Biochim. Biophys. Acta1831960–968. 10.1016/j.bbalip.2013.01.016
29
LecoutreS.DeracinoisB.LaborieC.EberleD.GuinezC.PanchenkoP. E.et al (2016). Depot- and sex-specific effects of maternal obesity in offspring’s adipose tissue.J. Endocrinol.23039–53. 10.1530/JOE-16-0037
30
LuX.Altshuler-KeylinS.WangQ.ChenY.SpontonC. H.IkedaK.et al (2019). Mitophagy controls beige adipocyte maintenance through a Parkin-dependent and UCP1-independent mechanism.Sci. Signal.111–21. 10.1126/scisignal.aap8526
31
MeexR. C.PhielixE.Schrauwen-HinderlingV.Moonen-KornipsE.SchaartG.SchrauwenP.et al (2010). The use of statins potentiates the insulin-sensitizing effect of exercise training in obese males with and without Type 2 diabetes.Clin. Sci.119293–301. 10.1042/CS20100153
32
MitraA.AlversK. M.CrumpE. M.RowlandN. E. (2009). Effect of high-fat diet during gestation, lactation, or postweaning on physiological and behavioral indexes in borderline hypertensive rats.Am. J. Physiol. Regul. Integr. Comp. Physiol.296R20–R28. 10.1152/ajpregu.90553.2008
33
NgM.FlemingT.RobinsonM.ThomsonB.GraetzN.MargonoC.et al (2014). Global, regional, and national prevalence of overweight and obesity in children and adults during 1980-2013: a systematic analysis for the Global Burden of Disease Study 2013.Lancet384766–781. 10.1016/S0140-6736(14)60460-8
34
NisoliE.TonelloC.CardileA.CozziV.BracaleR.TedescoL.et al (2005). Calorie restriction promotes mitochondrial biogenesis by inducing the expression of eNOS.Science310314–317. 10.1126/science.1117728
35
NovakM.HahnP.PennD.MonkusE.KirbyL. (1973). Metabolism of subcutaneous adipose tissue in the immediate postnatal period of human newborns. developmental changes in some cytoplasmic enzymes.Biol. Neonate2319–24.
36
ObregonM. J.JacobssonA.KirchgessnerT.SchotzM. C.CannonB.NedergaardJ. (1989). Postnatal recruitment of brown adipose tissue is induced by the cold stress experienced by the pups. an analysis of mRNA levels for thermogenin and lipoprotein lipase.Biochem. J.259341–346.
37
PalouM.PriegoT.SanchezJ.TorrensJ. M.PalouA.PicoC. (2010). Moderate caloric restriction in lactating rats protects offspring against obesity and insulin resistance in later life.Endocrinology1511030–1041. 10.1210/en.2009-0934
38
PouliotM. C.DespresJ. P.NadeauA.MoorjaniS.Prud’HommeD.LupienP. J.et al (1992). Visceral obesity in men. Associations with glucose tolerance, plasma insulin, and lipoprotein levels.Diabetes41826–834.
39
Prunet-MarcassusB.MoulinK.CarmonaM. C.VillarroyaF.PenicaudL.CasteillaL. (1999). Inverse distribution of uncoupling proteins expression and oxidative capacity in mature adipocytes and stromal-vascular fractions of rat white and brown adipose tissues.FEBS Lett.464184–188.
40
ReevesP. G.NielsenF. H.FaheyG. C.Jr. (1993). AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet.J. Nutr.1231939–1951.
41
ReillyJ. J.KellyJ. (2011). Long-term impact of overweight and obesity in childhood and adolescence on morbidity and premature mortality in adulthood: systematic review.Int. J. Obes.35891–898. 10.1038/ijo.2010.222
42
RossR.AruJ.FreemanJ.HudsonR.JanssenI. (2002). Abdominal adiposity and insulin resistance in obese men.Am. J. Physiol. Endocrinol. Metab.282E657–E663. 10.1152/ajpendo.00469.2001
43
SchottlT.KapplerL.BraunK.FrommeT.KlingensporM. (2015). Limited mitochondrial capacity of visceral versus subcutaneous white adipocytes in male C57BL/6N mice.Endocrinology156923–933. 10.1210/en.2014-1689
44
ShepherdD.GarlandP. B. (1969). The kinetic properties of citrate synthase from rat liver mitochondria.Biochem. J.114597–610.
45
SpaldingK. L.ArnerE.WestermarkP. O.BernardS.BuchholzB. A.BergmannO.et al (2008). Dynamics of fat cell turnover in humans.Nature453783–787. 10.1038/nature06902
46
SutherlandL. N.CapozziL. C.TurchinskyN. J.BellR. C.WrightD. C. (2008). Time course of high-fat diet-induced reductions in adipose tissue mitochondrial proteins: potential mechanisms and the relationship to glucose intolerance.Am. J. Physiol. Endocrinol. Metab.295E1076–E1083. 10.1152/ajpendo.90408.2008
47
TimmonsJ. A.WennmalmK.LarssonO.WaldenT. B.LassmannT.PetrovicN.et al (2007). Myogenic gene expression signature establishes that brown and white adipocytes originate from distinct cell lineages.Proc. Natl. Acad. Sci. U.S.A.1044401–4406. 10.1073/pnas.0610615104
48
VanhoutvinS. A.TroostF. J.HamerH. M.LindseyP. J.KoekG. H.JonkersD. M.et al (2009). Butyrate-induced transcriptional changes in human colonic mucosa.PLoS One4:e6759. 10.1371/journal.pone.0006759
49
WangQ. A.TaoC.GuptaR. K.SchererP. E. (2013). Tracking adipogenesis during white adipose tissue development, expansion and regeneration.Nat. Med.191338–1344. 10.1038/nm.3324
50
Wilson-FritchL.BurkartA.BellG.MendelsonK.LeszykJ.NicoloroS.et al (2003). Mitochondrial biogenesis and remodeling during adipogenesis and in response to the insulin sensitizer rosiglitazone.Mol. Cell. Biol.231085–1094.
51
Wilson-FritchL.NicoloroS.ChouinardM.LazarM. A.ChuiP. C.LeszykJ.et al (2004). Mitochondrial remodeling in adipose tissue associated with obesity and treatment with rosiglitazone.J. Clin. Invest.1141281–1289. 10.1172/JCI21752
52
WuJ.BostromP.SparksL. M.YeL.ChoiJ. H.GiangA. H.et al (2012). Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human.Cell150366–376. 10.1016/j.cell.2012.05.016
53
XueB.RimJ. S.HoganJ. C.CoulterA. A.KozaR. A.KozakL. P. (2007). Genetic variability affects the development of brown adipocytes in white fat but not in interscapular brown fat.J. Lipid Res.4841–51. 10.1194/jlr.M600287-JLR200
54
YamK. Y.NaninckE. F. G.AbbinkM. R.la FleurS. E.SchipperL.van den BeukelJ. C.et al (2017). Exposure to chronic early-life stress lastingly alters the adipose tissue, the leptin system and changes the vulnerability to western-style diet later in life in mice.Psychoneuroendocrinology77186–195. 10.1016/j.psyneuen.2016.12.012
55
YangY. K.ChenM.ClementsR. H.AbramsG. A.AprahamianC. J.HarmonC. M. (2008). Human mesenteric adipose tissue plays unique role versus subcutaneous and omental fat in obesity related diabetes.Cell. Physiol. Biochem.22531–538. 10.1159/000185527
56
ZimmermannM.ReichertA. S. (2017). How to get rid of mitochondria: crosstalk and regulation of multiple mitophagy pathways.Biol. Chem.39929–45. 10.1515/hsz-2017-0206
Summary
Keywords
white adipose tissue, mitochondria, browning, maturation, uncoupling protein, oxidative phosphorylation, obesity
Citation
Kodde A, Engels E, Oosting A, van Limpt K, van der Beek EM and Keijer J (2019) Maturation of White Adipose Tissue Function in C57BL/6j Mice From Weaning to Young Adulthood. Front. Physiol. 10:836. doi: 10.3389/fphys.2019.00836
Received
24 January 2019
Accepted
17 June 2019
Published
09 July 2019
Volume
10 - 2019
Edited by
Jean-Pierre Montani, Université de Fribourg, Switzerland
Reviewed by
Tobias Fromme, Technical University of Munich, Germany; Yuko Okamatsu-Ogura, Hokkaido University, Japan; David Wright, University of Guelph, Canada
Updates

Check for updates
Copyright
© 2019 Kodde, Engels, Oosting, van Limpt, van der Beek and Keijer.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Andrea Kodde, Andrea.Kodde@danone.com
This article was submitted to Integrative Physiology, a section of the journal Frontiers in Physiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.