ORIGINAL RESEARCH article

Front. Microbiol., 18 April 2019

Sec. Plant Pathogen Interactions

Volume 10 - 2019 | https://doi.org/10.3389/fmicb.2019.00639

Salmonella enterica Growth Conditions Influence Lettuce Leaf Internalization

  • 1. Microbial Food-Safety Research Unit, Department of Food Science, Agricultural Research Organization, The Volcani Center, Rishon LeZion, Israel

  • 2. Confocal Microscopy Unit, Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Rishon LeZion, Israel

Abstract

Human pathogens on plants (HPOP) have evolved complex interactions with their plant host. Stomatal internalization is one such mode of interaction, where bacteria are attracted to stomata and penetrate into the substomatal cavity by a process mediated by chemotaxis. Internalization enables HPOP to evade the hostile environment of the leaf surface and find a protected, nutrient-rich niche within the leaf. Numerous studies have documented attachment and entry of the foodborne pathogens, Salmonella enterica and Escherichia coli into stomata. Internalization, however, varies considerably among different pathogens and in different plants, and both bacterial and plant’s factors were reported to influence HPOP attachment and internalization. Here we have studied the effect of laboratory growth conditions, on the internalization of Salmonella enterica serovar Typhimurium (STm) into lettuce leaf. We have further tested the potential involvement of universal stress-proteins in leaf internalization. We found that STm grown in Luria Bertani broth devoid of NaCl (LBNS), or in diluted LB (0.5×LB) internalized lettuce leaf better (62 ± 5% and 59 ± 7%, respectively) compared to bacteria grown in LB (15 ± 7%). Growth under non-aerated conditions also enhanced STm internalization compared to growth under aerated conditions. Growth temperature of 25 and 37°C did not affect STm internalization, however, growth at 42°C, significantly augmented leaf internalization. Since, the tested growth conditions represent moderate stresses, we further investigated the involvement of five universal-stress genes in STm leaf internalization following growth in LBNS medium. Knockout mutations in ydaA, yecG, ybdQ, and uspAB, but not in ynaF, significantly reduced STm internalization compared to the wild-type (wt) strain, without affecting bacterial attachment and motility. Transduction of the mutations back to the parent strain confirmed the linkage between the mutations and the internalization phenotype. These findings support a specific role of the universal-stress genes in leaf internalization. The present study highlights the complexity of bacterial internalization process and may provide partial explanation for the variable, sometimes-contrasting results reported in the literature regarding stomatal internalization by HPOP. Characterization of the regulatory networks that mediate the involvement of usp genes and the tested growth factors in STm internalization should contribute to our understanding of human pathogens-plant interactions.

Introduction

Consumption of fresh vegetables has consistently increased over the last decades, since they are considered an important part of a healthy and low-calorie diet (Tirpanalan et al., 2011). Concomitantly, there is an increase in outbreaks of food-borne illness associated with the consumption of fresh produce (; ). Lettuce is one of the vegetables, which often linked to outbreaks of foodborne diseases. For example, from 1994 to 2011, more than 20 alerts associated with contaminated lettuce were reported through the RASFF portal of the EU (Tirpanalan et al., 2011). Although efforts to develop chemical and technological means to disinfect vegetables are ongoing (), there is currently no treatment that can effectively kill foodborne pathogens on fresh produce ().

Numerous studies have documented the ability of foodborne pathogens, such as Escherichia coli and Salmonella enterica, to colonize plants and interact with the plant immune system (; ) and are considered human pathogens on plants (HPOP). Several reports have demonstrated that HPOP may enter the plant tissues through roots or via natural openings on the plant surface, such as stomata, lenticels or sites of biological or physical injury (; ; Takeuchi and Frank, 2001; ; ; ; ). Internalization enables HPOP to evade the hostile environment of the soil and the plant surfaces and find a protected, water- and nutrient-rich niche within the plant. Internalization may also protect internalized HPOP against surface sanitation used by the fresh produce industry (; ). Consequently, understanding the factors that affect plant internalization by HPOP is needed toward developing new approaches to enhance the safety of fresh produce.

Attachment and internalization of HPOP are complex processes depending on both bacterial and plant factors. Plant’s factors include, plant growing conditions (; ; ), development stage (; ; ), plant’s cultivar (; ; ; ), as well as contamination site (). Bacterial factors that affect attachment and internalization include, cell concentration (; ; ), bacteria strain (; Wright et al., 2013; ) and biofilm formation (Yaron and Römling, 2014).

It has been demonstrated that preadaptation of human pathogens, including Salmonella enterica, to mild stresses enhanced their survival under more extreme stresses, as well as under other stress, in a process termed, cross protection (; ; ; Yuk and Schneider, 2006; ). It has been reported that exposure of bacteria to the vegetable environment stimulates a cellular response required to colonize the animal host intestine (). More recently, have demonstrated that pregrowth of Salmonella Typhimurium LT2 in lettuce medium, rather than in rich laboratory broth (Luria Bertani, LB) resulted in better survival of the pathogen in soil microcosms. It has been suggested that the medium used to pregrow Salmonella can influence its fate in the environment (). Likewise, we hypothesize that pregrowth conditions of laboratory-grown S. Typhimurium may also affect bacterial response required for interaction with the plant host, and specifically, affect stomatal internalization using lettuce leaf model system.

Materials and Methods

Bacterial Strains, Inoculum Preparation, and Fluorescence Labeling

Salmonella enterica serovar Typhimurium (STm) SL1344 strains and E. coli O157:H7 EDL933 strain were labeled with mCherry-fluorescence protein (mCherry) by electroporating plasmid pKB2690, containing the mCherry gene and ampicillin resistance gene (). Bacterial cultures were kept in Luria-Bertani (LB; 10 g Bacto-peptone, 5 g Yeast Extract, 10 g NaCl) broth containing 25% glycerol at -80°C. For each experiment, bacteria were streaked on LB agar for overnight and fresh colony were re-suspended in 10 ml LB broth and grown with shaking (150 rpm) for 18–20 h at 37°C to generate the inoculum for the internalization assay. In some cases, as indicated, bacteria were grown at 25 and 42°C. Other growth media that were used, included LB broth without NaCl (LBNS), and water-diluted LB broth (0.5×LB). Where indicate, bacteria were grown in LB broth without shaking or on LB agar plates. Overnight liquid cultures were washed twice with sterile saline (0.85% NaCl) by centrifugation (2700 g, 10 min) and re-suspended in saline to a final concentration of about 108 colony-forming units (CFU) per ml.

Generation of Knockout Mutants in Universal Stress Genes

Site-directed mutagenesis was performed as described by using primers specific to each of the mutated genes (Table 1). The absence of the intact gene in the mutants and the authenticity of the nearby DNA sequences were confirmed by PCR and sequence analyses using upstream- and downstream-chromosomal derived primers in combination with the respective Km-cassette derived primer. A list of primers used to generate the mutants and to confirm their sequence is present in Table 1.

Table 1

References/
PrimerForward sequenceReverse sequencesource
uspABTCATGAGCGCAATCAAGCTCACCACCACCAAACCG CATAACGCGCTGGTCTGTAGGCTGGAGCTGCTTCGGCAGCGGCACAATCAGCATGTCAACGTGAACGGTG TTGATCAGCTGGCGCCATATGAATATCCTCCTTAGThis study
uspA-RTACGTCAATCTGGGCGATATGGCTCAGGGTTTCAGTGATAGGThis study
yecGTCTATCGCCCGCCCTGTTCAGGCGAAAGTAAGCCT GATTACTCTCGCTTCTGTAGGCTGGAGCTGCTTCGTGCCGAGCAGGACGCGCGCGAAAAGAAACTGTGG TTATGGTTGCCGCAAACATATGAATATCCTCCTTAGThis study
yecG-RTAGGATTTACGCGCGGTTATGACTCACCTGATGCGATGAAAGThis study
ybdQGCGCAACAGGATGGCGTCATTCATCTGTTGCATGTA CTGCCTGGGTCCGCGCATATGAATATCCTCCTTAGACCACGCTTGAGGCGTTAGACCCCAACAGGTGTGT CGTGATGGACGGATTTGTAGGCTGGAGCTGCTTCGThis study
ybdQ-RTAAACGATGGTGGGACACTTCGACATCCGCATCCAGTTCTTThis study
ynaFCCCATCGATATTTCAGATTCAGAATTAACTCAACGC GTGATTTCGCATGTTGTAGGCTGGAGCTGCTTCGGAGCATTCCGCATGACGCACAACGGCTGCGGCGT TGGAACCCAACAGATACATATGAATATCCTCCTTAGThis study
ynaF-RTCTTCACTGGGACTGGCTTATTGCGGGAAGGTTGAATTTCTTGThis study
ydaACTGCGATGACAGTTGTAAGGAGACCCTGTATGGCT ATGTATCAAAATATGTGTAGGCTGGAGCTGCTTCGCAGTTCAACCGGTGTTTGATACTCATCAGGCTTAA TGACTAACAGGTCGCCATATGAATATCCTCCTTAGThis study
ydaA-RTCCGTGTGGATGGTCAAAGATTCGTTGAGAGCATTGTGATAGGThis study
rpoD-RTGGCTCGTTTGTCCGATCTTATCTTCGTCATCATCCAGGTCTTCThis study
k2CGGTGCCCTGAATGAACTGC
ktCGGCCACAGTCGATGAATCC
uspABtestGAAACTGGCCCGCTTTTTTATAGACCAGACGCGGTCTTAGCThis study
yecGtestGCACAATCTCATATTCTTGCAATCGTGGCGACGTTCCCTAAGThis study
ybdQtestCGGTTGATGTTTTTGAAATGGGGCAGGGCGTGTAAGTTTTThis study
ynaFtestAGTATCGTGGAGCAGCACCTGGCGATGATGATTGATTTGAThis study
This study
ydaAtestGCGCTTCCTCTGTTTCATTCAATAGGGTATTGGCCGGATGThis study

Primers used in this study.

To confirm the linkage between the leaf internalization phenotype and the usp mutations, each of the mutation was further transferred to the STm wt strain by P22 HT int-105 transduction, as described (). Transductants were isolated on Km plates and the presence of the specific mutation was confirmed by PCR using primers presented in Table 1.

Reverse Transcription Real Time PCR

STm SL1344 strain was grown in various media and growth conditions, as described above. Three milliliters of an overnight cultures (about 109 cells) were harvested by centrifugation (2700 g, 10 min) and total RNA was isolated by the RNAqueous® kit (Ca. No. AM1912), according to the manufacturer instructions (Ambion). DNase treatment and cDNA synthesis were performed using Maxima first strand cDNA synthesis kit with dsDNase (Thermo Scientific; Ca No. K16171). Primers for real time PCR of uspA, yecG, ybdQ, ydaA, ynaF, and rpoD genes were selected from STm SL1344 genomic sequence using the Syntezza-Israel IDT web portal (Integrated DNA Technologies; Leuven, Belgium), through the primer quest tool and are listed in Table 1. Fast SYBR® Green Master mix (AB#4385612), 96-wells plates (AB#4346906) and adhesive covers (AB#4311971) were purchased from Applied Biosystems. Real time PCR reactions (10 μl), included 1.72 ng cDNA, 0.2 μM each forward and reverse primers and 50% volume of Fast SYBR® Green Master mix (Applied Biosystems). Transcription of uspA, yecG, ybdQ, ydaA, and ynaF genes was evaluated by Real time PCR using Applied Biosystems StepOnePlusTM PCR system (Applied Biosystems, Foster City, CA, United States). The PCR conditions comprised 20 s at 95°C followed by 40 cycles at 95°C 3 s and 60°C for 30 s. To verify the specificity of each primer, a melting-curve analysis was included (60–95°C with fluorescence measured every 0.3°C). The threshold cycle (CT) value and relative quantification (RQ) level were determined by StepOneTM Software 2.1 (Applied Biosystem). The house-keeping gene, rpoD () served as a reference gene for normalization. Each run included a negative control and a cDNA reaction without reverse transcriptase to rule out DNA contamination. All experiments were performed in triplicates.

Lettuce Preparation

Fresh whole iceberg lettuce (Lactuca sativa) was purchased at a local retail store, and used immediately or kept in a refrigerator for 1 day. Before each experiment, the lettuce temperature was equilibrated at room temperature. The outermost leaves of the lettuce head were aseptically removed and the inner 2–3 leaves were taken for the experiments. The leaves were aseptically cut into ca. 3 × 3 cm pieces using a sterile scalpel, as described previously ().

Leaf Attachment and Internalization Assays

Interaction of bacteria with leaf pieces were tested, as described before (). Briefly, lettuce pieces were submerged in 30 ml saline in a 50 ml sterile polypropylene tube (Labcon, Petaluma, CA, United States), at one piece per tube. The leaves were pre-conditioned for 20 min under high intensity light (100 μE m-2 s-1) at 30°C. The saline was then replaced with 10 ml of mCherry-labeled bacterial suspension (in saline) containing about 108 CFU per ml. The tubes were incubated for 2 h under the same conditions. Leaf pieces were rinsed twice for 1 min in excess of saline to remove unattached bacteria and an internal small piece (10 × 5 mm) was excised and viewed immediately under confocal laser-scanning microscopy (CLSM). Bacterial localization was determined on the leaf surface (attachment) and in deeper layers (internalization) in 30 randomly chosen microscopic fields (magnification ×40). Internalization was quantified as the incidence of internalized bacteria, i.e., percentage of fields (×40) containing ≥1 internal mCherry-tagged bacteria in 30 microscopic fields of the same leaf tissue. STm attachment was scored as the number of microscopic fields containing: 0, 1–10, 10–50, 50–100, and >100 fluorescent cells per 90 fields (×40). Each experiment included three lettuce pieces from different leaves (in total 3 × 30 microscopic fields were examined per experiment), and was repeated independently at least three times at different days, with different lettuce heads.

Confocal Laser-Scanning Microscopy

mCherry-fluorescent bacteria were visualized by CLSM (Olympus IX81, Tokyo, Japan), using 40 × 0.7 objective. Fluorescence bacteria were visualized using excitation wavelength of 543 nm and a BA560-600 nm emission filter. Chlorophyll autofluorescence was detected using 488 nm excitation wavelength and emission filter BA 660 IF. Transmitted light images were obtained using Nomarski differential interference contrast (DIC).

Motility Tests

Swarming and Swimming motility assays were performed, as described previously with minor changes (). Briefly, freshly grown bacterial cultures were suspended in saline to a final concentration of ca. 108 CFU/ml. For swarming motility assay, bacterial suspensions (1 μl) were inoculated on the center of a swarm plate containing nutrient broth (NB) supplemented with 0.5% glucose and 0.6% agar. For testing swimming motility, a similar inoculum was inoculated with a sterile needle in the center of a well, in 12-wells plates, containing NB-glucose with 0.3% agar. The plates were incubated at 30°C for 18 h in a humid chamber. Swarming motility was assessed by measuring the radius of the swarm from the point of inoculation. Swimming motility was determined visually by the presence of turbidity in the entire volume of the inoculated well. The experiments were repeated independently five times. Nonmotile STm mutants, fliGHI, and motA (), served as an internal negative control for both motility assays. Swarming motility was presented as the average radius of the colony from the point of inoculation and standard errors of the means.

Statistical Methods

Comparison of the incidence of bacterial attachment and internalization was performed by ANOVA using the program Instat, version 3.0.6 (GraphPad Software, Inc., La Jolla, CA, United States). The comparisons of the relative quantity of the amplified mRNA in the reverse transcription real-time PCR experiments were done by unpaired Student’s t-test using GraphPad software. Statistical significance was set at a one tailed P ≤ 0.05.

Results

Effect of Growth Conditions on Salmonella Internalization

Growth of STm in LB broth resulted in the lowest incidence of internalization (15% ± 7), while growth in LBNS, or diluted LB (0.5×LB) resulted in a fourfold higher incidence of internalization, 62% ± 5 and 59% ± 7, respectively (Figure 1).

Figure 1

Growth temperature of 25 or 37C yielded similar incidence of Salmonella internalization (19% ± 6 and 16% ± 3, respectively), however, growth at 42°C significantly increased bacterial internalization (60% ± 6; Figure 2A).

Figure 2

Growth of STm in LB broth at 37°C, without shaking, also enhanced internalization (61% ± 11) compared to growth in shaking culture (18 ± 6%) (Figure 2B). On the other hand, bacteria that were grown on LB agar were poorly internalized (6 ± 1%) (Figure 2B).

Effect of LBNS on E. coli Internalization

Previous studies in our laboratory have failed to show substantial leaf internalization in the case of E. coli O157:H7 EDL933 pregrown in LB broth (data not shown). Given our findings regarding the effect of growth medium composition on STm internalization, it was of interest to examine, whether this is a more general phenomenon. Therefore, leaf internalization of E. coli O157:H7 pregrown in either LB broth or in LBNS was also tested. Similar to Salmonella, pregrowth of E. coli strains in LBNS broth resulted in higher leaf internalization compared to growth in LB broth (28 ± 3% and 1.8 ± 1.2%, respectively) (Figure 3).

Figure 3

In order to document the localization of LB- and LBNS-grown E. coli cells within the leaf tissue, mCherry-labeled bacteria were visualized by confocal microscopy. LBNS-grown bacteria were observed attached to the leaf surface with a distinct clustering pattern near and within stomata (Figure 4A,B). Images taken at various depths underneath the leaf surface demonstrated the presence of tagged bacteria within stomata and in the intercellular space (apoplast) of the spongy parenchyma in up to 55 μm depth (Figure 4C). A three-dimensional reconstruction model of fluorescent images taken at the same leaf region shows the presence of E. coli cells (pink) within a stomate (shown by the white rectangle) as well as in deeper layers of the leaf (Figure 4D). Similar z-section images and 3D reconstruction model performed on fluorescent images taken from leaves interacted with LB-grown E. coli, show no bacterial cells underneath the leaf surface (Figure 4E,F).

Figure 4

Involvement of Salmonella Universal Stress Proteins in Leaf Internalization

The extrinsic factors that enhanced STm internalization, included mild stresses, such as growth in low NaCl broth (LBNS), nutrients deficiency (diluted LB broth), high-temperature (42°C), and low-oxygen content (standing culture without shaking). Salmonella possess at least five genes (ydaA, yecG, ybdQ, ynaF, and uspAB), encoding universal stress proteins, whose function in Salmonella-plant interaction is not known. To study possible involvement of these genes in Salmonella internalization, mutations in ydaA, yecG, ybdQ, ynaF, and uspAB were generated in STm SL1344. The wild type (wt) strain and the five isogenic mutants were grown in LBNS broth, and tested for leaf internalization. Mutants uspAB, ydaA, yecG, ybdQ, but not ynaF, demonstrated significant reduction in internalization efficiency compared to the wt strain (Figure 5A). Representative confocal microscopy images illustrating the localization of wt STm and two mutant strains on the leaf surface and underneath the surface are presented in Figure 5B). To confirm that the phenotype of the mutants was linked to the presence of the specific knockout mutations, each of the mutations was transferred back to the wt strain by transduction. The transductants harboring mutations in uspAB, ydaA, yecG, and ybdQ, but not in ynaF, were also impaired in leaf internalization phenotype, similar to the original knockout mutants (Figure 5C). These findings provide further evidence regarding the role these genes have in STm leaf internalization.

Figure 5

The wt and ynaF mutant strains display substantial attraction to stomata and were located in high numbers within the leaf tissue. In contrast, only few cells of the yecG mutant strain were observed on the leaf surface, including stomata, while no cells were observed underneath the surface Figure 5B).

It is possible that the low internalization phenotype displayed by the mutants merely reflect impaired attachment to the lettuce leaf, or lack of motility, which is required for leaf internalization (). Confocal microscopy visualization demonstrated that both the wt and its isogenic mutants displayed comparable attachment to the leaf surface (Table 2). Furthermore, both swarming motility (Table 3) and swimming motility (data not shown) of all the mutants were similar to that of the wt strain, suggesting that uspAB, ydaA, yecG, and ybdQ genes have a specific role in leaf internalization, which does not involve motility or attachment.

Table 2

Number of microscope fields out of 90 (means ± SD)
harboring mCherry-tagged STm cells
Strains01–1010–5050–100100 ≤
wt04 ± 353 ± 1123 ± 68 ± 8
ΔynaF01 ± 0.547 ± 1428 ± 1113 ± 8
ΔuspAB016 ± 747 ± 1016 ± 66 ± 4
ΔydaA05 ± 357 ± 1117 ± 610 ± 10
ΔyecG021 ± 747 ± 1210 ± 310 ± 10
ΔybdQ011 ± 748 ± 927 ± 84 ± 4

Attachment of STm wild-type and mutant strains to lettuce leaf.

Table 3

StrainsSwarm distance (mm ± standard error)
wt36.4 ± 3.0
ΔynaF36.4 ± 3.5
ΔuspAB40.6 ± 1.2
ΔydaA36.2 ± 1.9
ΔyecG36.8 ± 0.9
ΔybdQ39.8 ± 1.4
ΔfliGHI44 ± 3.0
ΔmotA33 ± 3.0

Swarming motility assay.

Transcriptional Induction of Universal Stress Protein Genes Under Growth in LBNS

The data presented suggest that growth of STm under suboptimal conditions may induce the expression of the usp- and other genes that may facilitate leaf internalization. Since, the phenotypic analysis of the 5 usp genes was performed following growth of STm in LBNS, expression of the 5 usp genes was assessed following growth in LBNS compared to growth in LB at 37°C. Transcription of all the tested genes was induced following growth in LBNS compared to LB (Figure 6).

Figure 6

Discussion

We have previously, demonstrated that Salmonella enterica cells cluster near lettuce stomata and penetrate through the stomatal opening into the inner leaf tissue in a process that involved chemotaxis (). The ability of HPOP to internalize leafy greens has been documented in many studies (; ; Takeuchi and Frank, 2001; ; ; ), however, it seems that internalization varies greatly in different studies and is influenced by genetic factors and environmental of both bacteria and plants (; Zhang et al., 2009; ; Wright et al., 2013).

In most studies, HPOP internalization was examined following growth in rich laboratory media (; ; Takeuchi and Frank, 2001; ; ; ; ). In the present study, we have examined the idea that modulation of the growth conditions may affect STm internalization. We have demonstrated that leaf internalization was enhanced following pregrowth of STm under suboptimal growth conditions, representing bacterial adaptation to mild stresses, such as low salt (LBNS medium), O2-limitation, low nutrients (0.5×LB) and temperature (42°C). The obtained effect was not limited to STm, at least in regard to pregrowth in LBNS, as growth of E. coli O157:H7 in this medium has also improved leaf internalization compared to growth in LB broth. Internalization of E. coli O157:H7 in leafy vegetables is a controversial issue. Some researchers have reported that E. coli O157:H7 may reside within leaf tissue (; Takeuchi and Frank, 2000, 2001; ), while others failed to demonstrate E. coli O157:H7 internalization into lettuce leaves, regardless the type of lettuce, age of plant, or strain (Zhang et al., 2009; ). Similarly, also reported lack of internalization of E. coli O157:H7 in intact spinach leaves. Previous studies in our laboratory with E. coli O157:H7 also failed to demonstrate substantial internalization using our lettuce leaf model, describe in this study (unpublished data). While, other plant and bacterial factors may account for these contradictory results, it is possible that difference in bacterial growth conditions, or exposure to other extrinsic factors, prior to the internalization assay, may have account for this variability in the internalization efficiency.

The detailed mechanisms through which growth conditions alter the capacity of bacteria to internalize leaves are not known. It is anticipated that pregrowth conditions may adapt bacteria to cope with the plant host. In the case of pregrowth in low NaCl medium, it was previously reported that the expression of curli, also known as thin aggregative fimbriae (tafi) is induced during growth of Salmonella and E. coli in low osmolarity medium, such as LBNS (Zogaj et al., 2001). Curli are bacterial adhesin that mediate attachment to various surfaces and contribute to biofilm formation on abiotic surfaces (). Several studies have documented the involvement of curli also in the attachment of Salmonella and E. coli to plants (; ; ; ; Yaron and Römling, 2014). Furthermore, curli were shown to enhance the transfer of S. Typhimurium from contaminated irrigation water to parsley and contributed to Salmonella plant internalization (). Thus, it is possible that curli may also influence STm internalization into lettuce leaves. Testing internalization of STm curli mutants should provide a better understanding regarding their potential role in lettuce leaf internalization.

Leaf surface is considered a hostile environment, where both phytopathogens and HPOP encounter multiple stresses, such as limited nutrients, UV irradiation, temperature fluctuations and desiccation (; ; Underwood et al., 2007; ). It has been suggested that leaf internalization is a stress evasion strategy adapted by some phytopathogens and HPOP (). It might be hypothesized that pregrowing of Salmonella under non-optimal conditions may have induced a general stress response to overcome anticipated stresses, which among other features, induces mechanisms that contributes to leaf internalization. This idea is supported by the recent study of , who demonstrated that STm cells grown in lettuce-medium persist longer in soil microcosm compared to cells grown in LB broth ().

Adaptation of Salmonella to environmental conditions is mediated largely by overlapping regulatory systems that control the expression of numerous genes (). Universal stress proteins (USPs) are prevalent in all three domains of life. In bacteria, USP have a role in adaptation to several stresses, including oxidative stress, high temperature, low pH and hypoxia and are likely to contribute to the adaption of bacterial pathogens to the human host environment (; ; ; ). Knowledge regarding the role of USPs in phytopathogen-plant interaction is very limited (, transcriptomic base), and no data were reported regarding their potential role in human pathogen-plant interactions. Knockout mutants of STm in uspAB, yecG, ydaA, ynaF, and ydaA, encoding for UspAB, UspC, UspE, UspF, and UspG, respectively, were tested for their capacity to adhere to and internalize lettuce leaves. Mutations in uspAB, ydaA, yecG, and ybdQ significantly reduced STm internalization compared to the wt strain, while mutation in the ynaF gene showed no phenotype. Similarly, transduction of the mutations in uspAB, ydaA, yecG, and ybdQ back to the wt strain, resulted in a similar phenotype. It seems that expression of both uspAB, ydaA, yecG, and ybdQ is needed for leaf internalization.

To further examine if these genes are indeed induced during growth of STm in LBNS, RT-RT PCR analysis demonstrated that each of the studied USP genes was induced under growth in LBNS compared to growth in LB at 37°C. The finding that ynaF expression was also induced, although the phenotype of the ynaF deletion mutant was not affected, implies that not all genes induced under growth in LBNS are necessarily critical for leaf internalization.

Remarkably, the attachment of all the mutants to the leaf surface was comparable to that of the wt strain (data not shown), indicating that uspAB, ydaA, yecG, and ybdQ were not merely required for bacterial attachment.

It has been reported that in S. Typhimurium the uspA gene is induced by metabolic, oxidative, and temperature stresses, and that mutation in uspA gene leads to reduced stress tolerance (). UspA contributed to the in vivo virulence of S. Typhimurium in mice and to survival within the host (). Additionally, Salmonella Enteritidis uspAB mutant had a decreased ability to contaminate eggs and to persist in harmful environments, such as in the oviduct and eggs shell (). It has been reported that Salmonella faces similar stress in both mammalian and plant hosts (; ; ; Wiedemann et al., 2015; ). Our findings, regarding the involvement of specific USPs in STm colonization of internal leaf tissue, further support the idea that bacterial adaptation to stresses may be advantageous to confront comparable stresses in both mammalian- and plant-hosts.

Conclusion

Internalization of STm in lettuce leaf was affected by bacterial growth conditions. Exposure of the pathogen to mild stresses enhanced leaf internalization, possibly due to bacterial preadaptation, which also contributes to lettuce leaf internalization. The universal stress genes uspAB, ydaA, yecG, and ybdQ, but not ynaF gene, are required for lettuce leaf internalization. Further characterization of their role in STm internalization is needed in order to better understand how Salmonella and possibly other HPOP adapt to the hostile plant environment.

Statements

Author contributions

SS and YK designed the study and analyzed the results. YK, RP, and EB performed the experiments, except for RT-RT PCR. RG planned and performed the RT-RT PCR experiments, analyzed, and summarized the results. SS and YK wrote the manuscript.

Funding

This study was partially supported by BARD-NIFA Grant No. NB-8316-17.

Acknowledgments

SS acknowledges the EU COST Action CA16110 entitled: Control of Human Pathogenic Micro-organisms in Plant Production Systems.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

Summary

Keywords

Salmonella, internalization, stomata, attachment, leaf, lettuce, stress, E. coli

Citation

Kroupitski Y, Gollop R, Belausov E, Pinto R and Sela (Saldinger) S (2019) Salmonella enterica Growth Conditions Influence Lettuce Leaf Internalization. Front. Microbiol. 10:639. doi: 10.3389/fmicb.2019.00639

Received

04 July 2018

Accepted

13 March 2019

Published

18 April 2019

Volume

10 - 2019

Edited by

Nicola Holden, James Hutton Institute, United Kingdom

Reviewed by

Stephen Chivasa, Durham University, United Kingdom; Divine Yufetar Shyntum, University of Pretoria, South Africa

Updates

Copyright

*Correspondence: Shlomo Sela (Saldinger),

This article was submitted to Plant Microbe Interactions, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics