High Prevalence of blaNDM Variants Among Carbapenem-Resistant Escherichia coli in Northern Jiangsu Province, China

The continuous emergence of carbapenem-resistant Escherichia coli (CRECO) presents a great challenge to public health. New Delhi metallo-lactamase (NDM) variants are widely disseminated in China, so the research on the prevalence and transmission of diverse bla_NDM variants is urgently needed. In the present study, 54 CRECO isolates were collected from 1,185 Escherichia coli isolates in five hospitals in Northern Jiangsu Province, China from September 2015 to August 2016. Antimicrobial susceptibility tests, PCR detection of resistance determinants, multi-locus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) were performed to characterize these strains. Plasmid conjugation experiments were carried out to determine the transferability of resistant genes from selected isolates. PCR-based replicon typing (PBRT), S1 nuclease-PFGE, and Southern blotting were conducted for plasmid profiling. Carbapenemase genes were detectable in all CRECO isolates, among which thirty-one CRECO isolates were found to carry bla_NDM−5 (54.7%), while, bla_NDM−1, bla_NDM−7, bla_NDM−4, bla_NDM−9, and bla_KPC−2 were identified in 14, five, two, one, and one isolates, respectively. MLST results revealed 15 different STs and four new STs were first reported to be linked with NDM-producing isolates. PFGE typing showed that no more than two isolates with the same ST appeared to the same band pattern except three ST410 isolates. Twenty-six selected NDM-producing isolates were successfully transferred to E. coli J53 by conjugation experiments. Notably, 50.0% (13/26) of bla_NDM variants were found to be carried by ~55 kb IncX3 plasmid. Our study reported a high prevalence of bla_NDM variants, especially bla_NDM−5, in Northern Jiangsu province, China. Diverse bla_NDM variants were mainly carried by ~55 kb IncX3 plasmids, suggesting that the fast evolution and high transferability of this kind of plasmid promote the high prevalence of bla_NDM variants. Therefore, large-scale surveillance and effective infection control measures are also urgently needed to prevent diverse bla_NDM variants from becoming epidemic in the future.

Introduction

Carbapenem, a β-lactam that is highly potent against Gram-negative bacteria, has been recognized as a last resort for treating of infections caused by multidrug-resistant bacteria. However, the increasing number of carbapenem-resistant Enterobacteriaceae (CRE) is unexpected despite infection control efforts, and it poses a great challenge to clinic (Zilberberg and Shorr, 2013). Carbapenem resistance is predominantly attributed to the presence of carbapenemases, among which Class A (bla_KPC), Class B (bla_NDM, bla_VIM, bla_IMP), and Class D (bla_OXA−48) types are most common for Enterobacteriaceae (Walsh, 2010; Albiger et al., 2015). An emerging carbapenemase, New Delhi metallo-lactamase (NDM), was first reported in a Swedish patient with a hospitalization history in India, it exhibited resistant to all β-lactams except for monobactams, and has great potential to cause global health crisis (Yong et al., 2009). Initially, bla_NDM gene was endemic to India subcontinent and NDM-producing isolates tested worldwide have geographical links with these high prevalence areas. However, an increasing number of regions worldwide have reported that patients with bla_NDM−positive isolates have never been abroad, indicating that bla_NDM genes are also associated with some special clones (Leverstein-Van et al., 2010).

In China, since the first report of bla_NDM gene in four carbapenem-resistant Acinetobacter baumannii isolates (Chen et al., 2011), increasing Enterobacteriaceae have been identified as carriers of the bla_NDM gene. Escherichia coli, an important member of Enterobacteriaceae, are often spread globally through some epidemiological lineages. Although the prevalence of NDM-producing CRE strains is low, outbreaks caused by bla_NDM-positive isolates have been identified in several regions of China, indicating high transferability of the bla_NDM gene and the severity of infections caused by bla_NDM−1-positive organisms (Wang et al., 2014; Jin et al., 2015; Yu et al., 2016). Furthermore, Kaase et al. (2011) first reported a novel bla_NDM variant, bla_NDM−2, which differs by one amino acid substitution (Pro28Ala) from bla_NDM−1, and the subsequent discovery of other bla_NDM variants highlights the rapid evolution of this multi-drug resistance gene. In 2012, the NDM enzyme reservoir, India, first reported diverse bla_NDM variants among Enterobacteriaceae and bla_NDM variants exhibited higher minimum inhibitory concentration (MIC) levels of carbapenem compared with bla_NDM−1 (Rahman et al., 2014). Although the bla_NDM gene is continuously recoverable in China, data on the prevalence and characteristics of bla_NDM variants among Enterobacteriaceae are still needed for preventing its transmission. Notably, a study conducted by Hu et al. (2017) have discovered that various species of bacteria harbored several kinds of bla_NDM variants in China, which were mainly carried by diverse plasmids with different sizes. In the present study, we reported a high prevalence of bla_NDM variants among E. coli from five hospitals in Northern Jiangsu Province, China. Moreover, these diverse bla_NDM variants were mainly located on the same plasmid.

Materials and Methods

Study Design

From September 2015 to July 2016, five hospitals (two in Xuzhou, two in Suqian, and one in Lianyungang) in Northern Jiangsu Province of China collected 1,185 E. coli isolates to examine the prevalence and molecular epidemiology of carbapenem-resistance isolates. Initial species identification and antimicrobial susceptibility testing was performed by the Vitek 2 system (bioMe'rieux, France) and MALDI-TOF MS (Bruker Microflex LT, Bruker Daltonik GmbH, Bremen, Germany) according to the manufacturer's instructions.

Antimicrobial Susceptibility Testing

Initial susceptibility testing was examined by Vitek 2 system. Further MICtesting was conducted by agar dilution method for cefoxitin, ceftriaxone, ceftazidime, cefepime, aztreonam, amikacin, ciprofloxacin, tigecycline, and piperacillin/tazobactam. The MICs of imipenem, meropenem, and ertapenem were determined by E-tests. For colistin, MIC values were tested by broth microdilution method. The agar dilution method and E-test were performed according to the standard Clinical and Laboratory Standards Institute guideline (M100-S26) (CLSI, 2017). The breakpoints of Food and Drug Administration (FDA) and European Committee on Antimicrobial Susceptibility Testing were used for tigecycline and polymyxin, respectively.

Molecular Detection of Resistance Genes

DNA templates were prepared by alkaline lysis method using the kit (MoBio, USA). Carbapenemase genes (bla_KPC bla_NDM, bla_SME, bla_GES,bla_VIM, bla_IMP, and bla_OXA−48) (Senda et al., 1996; Queenan et al., 2000; Poirel et al., 2004; Endimiani et al., 2008; Yang et al., 2012; Pereira et al., 2015; Al-Agamy et al., 2017), extended spectrumβ-lactamase genes (bla_SHV, bla_TEM, bla_{CTX−M−1group}, bla_{CTX−M−2group}, bla_{CTX−M−8group}, and bla_{CTX−M−9group}) (Schmitt et al., 2007; Yu et al., 2007), and plasmid-mediated AmpC genes(bla_ACC, bla_FOX, bla_MOX, bla_DHA, bla_CIT/SPM, and bla_EBC) (Pérez-Pérez and Hanson, 2002) were examined by PCR. E. coli ATCC25922 was used for the quality control. Positive amplifications were subject to Sanger sequencing (GENEWIZ Company, Suzhou, China).

PFGE and MLST

Molecular typing of 54 NDM-producing E. coli isolates was performed by pulsed-field gel electrophoresis (PFGE). The plugs containing genomic DNA were prepared according to the procedure described by Pereira et al. (2015). The DNA fragments digested with restriction endonuclease XbaI (TaKaRa Biotechnology, Dalian, China) were separated by PFGE on 1% SeaKem Gold agarose (Lonza, Rockland, ME, USA) using the CHEF Mapper XA PFGE system (Bio-Rad, USA) for 18 h at 14°C. The electrophoretic switch times were 6.8–35.4 s. Salmonella H9812 was used as reference marker. Dice coefficients was used to calculate the similarity of PFGE patterns. Dendrograms were constructed by the unweighted pair group method with arithmetic averages (UPGMA) using BioNumerics software version 5.10. Isolates were categorized to be of the same cluster when their dice similarity index was ≥85%. Multi-locus sequence typing of E. coli was conducted by PCR as previously described (Wirth et al., 2006). The allelic profiles and sequence types were identified by amplifying and sequencing the seven housekeeping genes (adk, fumC, gyrB, icd, mdh, purA, recA) according to the reference website (https://enterobase.warwick.ac.uk/species/index/ecoli). A minimum spanning tree of 54 bla_NDM-positive isolates was also constructed by BioNumerics software version 5.10.

Conjugation Assay

The conjugation experiment was implemented by mix broth mating among 26 selected isolates. The donor (clinical strains harboring the bla_NDM gene) and recipient (sodium azide-resistant E. coli J53) were mixed and cultured in broth at 37°C overnight. The transconjugants were selected on MH agar with sodium-azide (180 μg/mL) and imipenem (1 μg/mL). Initial species identification was conducted by Vitek MS system. Transformants were regarded as transconjugants when it exhibited resistance to carbapenem and harbored the bla_NDM gene.

Plasmid Analysis

Twenty-six selected isolates, including bla_NDM-₅ and bla_NDM-₁ gene with different STs from the aforementioned five different hospitals and all bla_NDM-₄ (one isolates was lost in transit), bla_NDM-₇, and bla_NDM-₉-positive isolates, were subjected to further plasmid analysis. Incompatibility groups of plasmids extracted from transconjugants were determined by PCR-based replicon typing as described previously (Carattoli et al., 2005; Johnson et al., 2012). S1-PFGE and Southern blotting were conducted to isolate and locate resistance plasmids. Briefly, the gel plugs embedded with bla_NDM-positive isolates were digested with S1 nuclease (TaKaRa Biotechnology, Dalian, China) and linear plasmids were separated by CHEF-Mapper XA PFGE system (Bio-Rad) as described above. The universal primers (F: GAAGCTGAGCACCGCATTAG; R: GGGCCGTATGAGTGATTGC) were used for probe synthesis. The plasmid DNA were transferred to positive-charged nylon membranes (Millipore, USA), and DIG-labeled bla_NDM−specific probe served to hybridize plasmids according to the instructions of the DIG High Prime DNA Labeling and Detection Starter Kit (Roche, USA).

Results

Clinical Data and Prevalence of Carbapenemase Genes Among CRECO

A total of 54 (4.56%, 54/1185) non-duplicate E. coli isolates that exhibited resistance to imipenem or meropenem were obtained from five hospitals in Northern Jiangsu Province, China. The Affiliated Hospital of Xuzhou Medical University (Hosptial A, n = 18), the Children's Hospital of Xuzhou (Hosptial B, n = 13), the People's Hospital of Suqian (Hosptial C, n = 11), the First People's Hospital of Suqian (Hosptial D, n = 6), and the Second People's Hospital of Lianyungang (Hosptial E, n = 6) were included. Among 54 CRECO isolates, 53 (98.1%, 53/54) were found to be bla_NDM-positive and 1 was bla_KPC−2-positive. Interestingly, five different bla_NDM variants were identified in this collection (Figure 1). Among them, the bla_NDM−5 was the prevailing variant, accounting for 58.5% (31/53) of bla_NDM-positive isolates, followed by bla_NDM−1 (26.4%, 14/53). Moreover, bla_NDM−7, bla_NDM−4, and bla_NDM−9 genes were also identified in 5, 2, and 1 isolates, respectively. NDM variations in amino acid substitutions at various positions are shown in Table 1. The distribution of the bla_NDM variants in hospitals is depicted in Figure 1.

FIGURE 1

Figure 1. The distribution of bla_NDM variants among different hospitals. Hospital A, the Affiliated Hospital of Xuzhou Medical University; Hospital B, the Children's Hospital of Xuzhou; Hospital C, the People's Hospital of Suqian; Hospital D, the First People's Hospital of Suqian; Hospital E, the Second People's Hospital of Lianyungang.

TABLE 1

Table 1. Amino acid substitutions of initially reported NDM variants.

Antimicrobial Susceptibility Patterns and Prevalence of Additional Resistance Genes of NDM-Producing CRECO

Fifty-three NDM-producing CRECO isolates were resistant to all cephalosporins (cefoxitin, ceftriaxone, ceftazidime, and cefepime) and enzyme inhibitors (piperacillin/tazobactam) but remained susceptible to colistin and tigecycline. The resistance rates to aztreonam, amikacin, and ciprofloxacin were 84.9, 22.6, and 92.4%, respectively. As shown in Table 2, among 31 bla_NDM−5-positive isolates, 93.5% were resistant to ciprofloxacin, 74.2% to aztreonam, and 32.2% to amikacin. Resistance to aztreonam and ciprofloxacin were 85.7 and 92.9% among 14 bla_NDM−1-producing isolates and were susceptible to amikacin. As for bla_NDM−7-positive isolates, susceptibility was only found for amikacin. The bla_NDM−4 and bla_NDM−9 isolates were resistant to all antibiotics tested in this study except for colistin and tigecycline. One bla_KPC−2-positive isolate was resistant to amikacin, colistin, and tigecycline. Molecular features revealed that most CRECO isolates carried the ESBLs gene, AmpC gene, or both. Overall, bla_CTX−M, bla_SHV, and bla_TEM were identified in 42, 11, and 32 isolates, respectively. bla_CTX−M-₁₅ was the most common ESBLs gene in our study, accounting for 26.4% followed by bla_CTX−M-₅₅ (n = 9), bla_CTX−M-₆₅ (n = 8), bla_CTX−M-₁₄ (n = 8). bla_CTX−M-₆₄ (n = 1), bla_CTX−M-₉₀ (n = 1), and bla_CTX−M-₁₂₃ (n = 1). All bla_TEM positive isolates were identified as bla_TEM−1. Moreover, 6 bla_CMY−2, 5 bla_CMY−42, and 1 bla_DHA−1 were also identified.

TABLE 2

Table 2. Antimicrobial susceptible patterns of NDM-producing Escherichia coli.

Molecular Typing of CRECO

A total of 15 STs were identified in 54 CRECO isolates (Figure 2). Among 53 bla_NDM-producing isolates, ST167 was the most prevalent, accounting for 35.8% (19/53), followed by ST410 (16.9%, 9/53), ST617 (13.2%, 7/53), ST405 (5.6%, 3/53), ST155 (3.8%, 2/53), ST156 (3.8%, 2/53), ST361 (3.8%, 2/53), and ST2659 (3.8%, 2/53). ST90, ST224, ST46, ST648, ST2376, and ST2083 were identified in one isolate. ST167 and ST617 are different by one allele and both correspond to clonal complex CC10. Moreover, ST410 and ST90 belong to clonal complex CC23. One KPC-2-producing isolate belong to ST131. PFGE typing revealed that no more than two isolates with the same ST type appeared to the same band pattern except for three ST410 isolates from hospital B (Figure 3). Surprisingly, the two isolates (E11 and E28) from hospital A and B shared the same patterns, indicating the occurrence of cross-transmission between hospitals.

FIGURE 2

Figure 2. Minimum spanning tree of 54 CRECO isolates from different hospitals.

FIGURE 3

Figure 3. Dendrogram of PFGE profiles of 54 CRECO isolates. The UPGMA algorithm was used to construct dendrogram based on the dice similarity coefficient. Isolates were categorized to be of the same cluster when their dice similarity index was ≥ 85%.

Characteristic of Plasmids Harboring the bla_NDM Gene

All of plasmids haboring bla_NDM gene from 26 selected CRECO isolates were successfully transferred to E. coli J53, and transconjugants exhibited resistance to carbapenem, cephalosporins and enzyme inhibitors (Table 3). As shown in Figure 4, S1-PFGE and Southern blotting revealed that all bla_NDM−5 genes were located on the same size (~55 kb) plasmids, which was associated with IncX3 (n = 5), IncFI (n = 3), IncFII (n = 1), and untypeable replicon (n = 3). The bla_NDM−1 genes were carried by 55~210 kb plasmids, including IncX3 (n = 5), IncFI (n = 1), and IncFII (n = 1) replicon types. Among five bla_NDM−7 positive isolates, four harbored ~55 kb IncX3 plasmids with DIG-labeled bla_NDM−7, and the remaining one was carried by ~110 kb IncFI plasmid. The bla_NDM−4 and bla_NDM−9 genes were located on ~55 kb IncX3 and ~110 kb IncI1 plasmids, respectively. Surprisingly, E5 isolates harbored three bla_NDM−5−positive plasmids of ~55, ~105, and ~320 kb in size, suggesting high insertion efficiency of the bla_NDM gene. Further plasmid sequencing from E5 isolates revealed that the respective GenBank accession numbers for ~55 and ~105 kb plasmids were NC_022740.1 and AP018144.1, however, the nucleotide sequences of ~320 kb plasmid could not be completely obtained.

TABLE 3

Table 3. Antimicrobial susceptible patterns and characteristics of 26 selected NDM-producing Escherichia coli (μg/mL).

FIGURE 4

Figure 4. Isolation and determination of plasmids harboring the bla_NDM gene in 26 clinical and transconjugants (Top: S1-nuclease PFGE patterns; Bottom: Southern blotting with a bla_NDM specific probe). The arrows represent thelocation of linear plasmid DNA hybridized with the bla_NDM specific probe. M: Braenderup H9812 Marker; lane 1: E5; lane 2: E7; lane 3: E12; lane4: E22; lane 5: E21; lane 6: E28; lane 7: E36; lane 8: E37; lane 9: E49; lane 10: E33; lane 11: E47; lane 12: E48; lane 13: E15; lane 14: E3; lane 15: E20; lane 16: E8; lane 17: E44; lane18: E32; lane 19: E53; lane 20: E6; lane 21: E16; lane 22: E38; lane 23: E39; lane 24: E41; lane 25: E45; lane 26: E46.

Discussion

Metallo-lactamase, NDM, is an emerging carbapenem-resistant β-lactamase that is of major public concern due to its high medical and economic burden (Otter et al., 2017), especially for developing countries such as India, Pakistan, and the Balkan countries. As the most populous country in the world, there are major difficulties in preventing the dissemination of multidrug resistant genes in China. Therefore, comprehensive, extensive studies on diverse bla_NDM variant-positive E. coli are needed to provide clear information to optimize antibiotic policy in endemic areas.

Generally, the prevalence of the bla_NDM gene has continuously increased worldwide. As of now, the NDM enzyme has been identified in almost all of the world, including many countries in Asia, Africa, Europe, the Americas, and Australia (Berrazeg et al., 2014). A study from India also analyzed the occurrence of the bla_NDM gene among carbapenem resistant isolates, and it accounted for 45.4% of them (Rahman et al., 2018). Recently, a survey from the French National Reference Center revealed that among 140 carbapenem-resistant isolates 21% were NDM producer (Gauthier et al., 2018). In 2017, a nationwide study of clinical CRE strains in China demonstrated that 49% were NDM producer among carbapenem-resistant E. coli (Zhang et al., 2017). Furthermore, a multicenter study of the China CRE network revealed that among 39 carbapenem-resistant E. coli isolates, 74.4% were NDM producer, suggesting that there is a serious challenge in combating infections caused by this “superbug” in China (Zhang et al., 2018). In the present study, we identified 53 bla_NDM-carrying isolates among 54 CRECO, which is much higher than in any other region of China (Wang S. et al., 2016; Hu et al., 2017; Liang et al., 2017). To the best of our knowledge, this is also the first report on the bla_NDM gene in Northern Jiangsu Province. Moreover, the emergence of such a high prevalence of bla_NDM variants indicates that the bla_NDM gene is increasing in this area.

Since its first identification in 2009, the bla_NDM gene has evolved at a fast pace during the past 10 years. Twenty-one bla_NDM variants have been identified in different countries, all of which are archived at http://www.lahey.org/Studies/other.asp. Khan et al. (2017) reported that the Asian continent, especially China and India, was a reservoir of NDM producers, in which about a 58.2% abundance of the bla_NDM−1 variants was found. Among these bla_NDM variants, the bla_NDM−1 gene has been reported as the most prevalent type worldwide (Nordmann and Poirel, 2014). In our study, five bla_NDM variants were identified as responsible for MBL production, with the bla_NDM−5 gene being the most prevalent. Compared with NDM-1, NDM-5 producers exhibited higher hydrolytic activity and toxicity toward carbapenem and cephalosporin (Mei et al., 2017). The bla_NDM−5 gene is an emerging bla_NDM variants and has tended to surpass bla_NDM−1 recently, and it differs from the NDM-1 enzyme at two amino acid substitutions, exhibited increased carbapenem resistance (Zhang et al., 2016). The bla_NDM−4 and bla_NDM−7 genes have been discovered among E. coli in China with relatively low prevalence, involving in 4 and 6 patients, respectively. Moreover, clinical bla_NDM−9-positive E. coli has only been found in Taiwan (Lai et al., 2017), with this being the first report on the mainland China. Moreover, not merely NDM-5, amino acid substitutions in NDM-4 (M154L), NDM-7 (D130A), and NDM-9 (E152A) could also result in high levels of carbapenem resistance (Düzgün, 2018). Stewart et al. (2017) reported that the substitution in M154L, which is found in most bla_NDM variants, could enhance resistance to ampicillin at low zinc(II) concentrations relevant to infection sites.

bla_NDM variant-positive isolates exhibited multi-drug resistance. Variable resistances to aztreonam, amikacin, and ciprofloxacin were identified in NDM-1 and NDM-5-producing E. coli. The NDM-7, NDM-4, and NDM-9-producing isolates exhibited pan-resistant phenotypes, showing resistance to almost all commonly used clinical antibiotics except for colistin and tigecycline. In view of this, the expert recommended polymyxins was regarded as the last resort for NDM-producing isolates (Yamamoto and Pop-Vicas, 2014).

ST167 was confirmed as significant carrier in the present study, and is reported to be associated with the production of the NDM enzyme, especially NDM-5 (Chen et al., 2016). Notably, four bla_NDM-positive ST617 strains were identified in the world, but we identified 6 isolates in the present study. Moreover, a novel new variant of bla_NDM, bla_NDM−21, belonged to ST617, which should deserve more attention (Liu et al., 2018). Furthermore, four new STs ST361, ST46, ST2376, and ST2083 were firstly reported to be linked with NDM-producing isolates.

The high efficiency of transfer renders the NDM producer ubiquitous throughout the world. Torres-González et al. (2015) reported an outbreak caused by bla_NDM−1-carrying plasmid, which is easily transferred between E. coli and Klebsiella pneumoniae. Similarly, in the present study, the plasmids of 26 selected CRECO isolates were also tested for transfer. All selected bla_NDM−5 genes were identified to be located on 55 kb plasmid, among which IncX3 was the most common replicon type. Notably, bla_NDM−5 gene was frequently reported to be carried by the IncX3 plasmid of 55 kb in size, which was widely reported in China (Yang et al., 2014), Inidia (Krishnaraju et al., 2015), Australia (Wailan et al., 2015), and Damark (Hammerum et al., 2015). Moreover, Li et al. (2018) reported that IncX3 type plasmids play an important role in the transmission of the bla_NDM−5 gene in Enterobacteriaceae and this kind of plasmid occurred in different species. Further illustrated the challenge of preventing the dissemination of the bla_NDM−5 gene. The widespread bla_NDM−1-carrying plasmid has been found to be associated with multiple replicon types, including IncX3, IncF, and IncA/C etc. In agreement with previous studies (Göttig et al., 2013; Wang L. H. et al., 2016), four bla_NDM−7-positive plasmids were identified as ~55 kb IncX3 type, while the bla_NDM−7 gene was also detected in the IncFI plasmid, which have been identified in India (Rahman et al., 2014). As for bla_NDM−9, to the best of our knowledge, this is the first report on ~105 kb IncI1 type plasmid harboring bla_NDM−9 gene. Overall, most plasmids harboring bla_NDM variants were identified as 55 kb IncX3 types, hinting that amino acid mutations might occur in the process of plasmid transfer, resulting in the emergence of bla_NDM variants. The high prevalence of the bla_NDM genes due in part to plasmid transfer, meanwhile, the fast evolution of this multidrug resistance gene also favors the persistence of such bacteria harboring it.

In summary, the present study reported high prevalence of bla_NDM variants, especially bla_NDM−5, among carbapenem-resistant E. coli in Northern Jiangsu Province. The presence of five different variants further increases the threat to public health because of the limited treatment options. Notably, diverse bla_NDM variants were mainly located on ~55 kb IncX3 plasmids, indicating that the fast evolution and high transferability of this kind of plasmid has led to the high prevalence of bla_NDM variants. Timely detection of NDM enzyme and antimicrobial susceptibility testing are necessary so that infections caused by NDM producers receive appropriate and effective therapy. Similarly, large-scale surveillance and effective infection control measures are also urgently needed to prevent diverse bla_NDM variants from becoming epidemics in the future.

Author Contributions

The laboratory measurements were performed by RB, ZK, and HQ. BG and PM participated in experimental design and manuscript revision. Data analysis were implemented by RB, ZK, HQ, FJ, and HK.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

This research was supported by the National Natural Science Foundation of China (81471994), Jiangsu Provincial Natural Science Foundation (BK20151154), Jiangsu Provincial Medical Talent (ZDRCA2016053), Six Talent Peaks Project of Jiangsu Province (WSN-135), Advanced Health Talent of Six-One Project of Jiangsu Province (LGY2016042), and Jiangsu Provincial Commission of Health and Family Planning Research Project (H201631).

References

Al-Agamy, M. H., Jeannot, K., El-Mahdy, T. S., Shibl, A. M., Kattan, W., Plésiat, P., et al. (2017). First detection of GES-5 carbapenemase-producing Acinetobacter baumannii isolate. Microb. Drug Resist. 23, 556–562. doi: 10.1089/mdr.2016.0152

PubMed Abstract | CrossRef Full Text | Google Scholar

Albiger, B., Glasner, C., Struelens, M. J., Grundmann, H., and Monnet, D. L. (2015). Carbapenemase-producing Enterobacteriaceae in Europe: assessment by national experts from 38 countries, May 2015. Euro. Surveill. 20:30062. doi: 10.2807/1560-7917.ES.2015.20.45.30062

PubMed Abstract | CrossRef Full Text | Google Scholar

Berrazeg, M., Diene, S., Medjahed, L., Parola, P., Drissi, M., Raoult, D., et al. (2014). New Delhi Metallo-beta-lactamase around the world: an eReview using Google Maps. Euro. Surveill. 19:20809.

Google Scholar

Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K. L., and Threlfall, E. J. (2005). Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods 63, 219–228. doi: 10.1016/j.mimet.2005.03.018

PubMed Abstract | CrossRef Full Text | Google Scholar

Chen, D., Gong, L., Walsh, T. R., Lan, R., Wang, T., Zhang, J., et al. (2016). Infection by and dissemination of NDM-5-producing Escherichia coli in China. J. Antimicrob. Chemother. 71, 563–565. doi: 10.1093/jac/dkv352

PubMed Abstract | CrossRef Full Text | Google Scholar

Chen, Y., Zhou, Z., Jiang, Y., and Yu, Y. (2011). Emergence of NDM-1-producing Acinetobacter baumannii in China. J. Antimicrob. Chemother. 66, 1255–1259. doi: 10.1093/jac/dkr082

PubMed Abstract | CrossRef Full Text | Google Scholar

Clinical and Laboratory Standards Institute [CLSI]. (2017). Performance Standards for antimicrobial Susceptibility Testing, 27th Informational Supplement. Wayne, PA: Clinical and Laboratory Standards Institute.

Düzgün, A. Ö. (2018). Effect of amino acid substitution in New Delhi metallo-β-lactamase on carbapenem susceptibility. Acta Microbiol. Immunol. Hung. 13, 1–9. doi: 10.1556/030.65.2018.022

CrossRef Full Text | Google Scholar

Endimiani, A., Carias, L. L., Hujer, A. M., Bethel, C. R., Hujer, K. M., Perez, F., et al. (2008). Presence of plasmid-mediated quinolone resistance in Klebsiella pneumoniae isolates possessing blaKPC in the United States. Antimicrob. Agents Chemother. 52, 2680–2682. doi: 10.1128/AAC.00158-08

PubMed Abstract | CrossRef Full Text | Google Scholar

Gauthier, L., Dortet, L., Cotellon, G., Creton, E., Cuzon, G., Ponties, V., et al. (2018). Diversity of Carbapenemase-producing Escherichia coli isolates in France in 2012-2013. Antimicrob Agents Chemother. 62:e00266–18. doi: 10.1128/AAC.00266-18

PubMed Abstract | CrossRef Full Text | Google Scholar

Göttig, S., Hamprecht, A. G., Christ, S., Kempf, V. A., and Wichelhaus, T. A. (2013). Detection of NDM-7 in Germany, a new variant of the New Delhi metallo-β-lactamase with increased carbapenemase activity. J. Antimicrob. Chemother. 68, 1737–1740. doi: 10.1093/jac/dkt088

PubMed Abstract | CrossRef Full Text | Google Scholar

Hammerum, A. M., Hansen, F., Olesen, B., Struve, C., Holzknecht, B. J., Andersen, P. S., et al. (2015). Investigation of a possible outbreak of NDM-5-producing ST16 Klebsiella pneumoniae among patients in Denmark with no history of recent travel using whole-genome sequencing. J. Glob. Antimicrob. Resist. 3, 219–221. doi: 10.1016/j.jgar.2015.05.003

PubMed Abstract | CrossRef Full Text

Hu, X., Xu, X., Wang, X., Xue, W., Zhou, H., Zhang, L., et al. (2017). Diversity of New Delhi metallo-beta-lactamase-producing bacteria in China. Int. J. Infect. Dis. 55, 92–95. doi: 10.1016/j.ijid.2017.01.011

PubMed Abstract | CrossRef Full Text | Google Scholar

Jin, Y., Shao, C., Li, J., Fan, H., Bai, Y., and Wang, Y. (2015). Outbreak of multidrug resistant NDM-1-producing Klebsiella pneumoniae from a neonatal unit in Shandong Province, China. PLoS ONE 10:e0119571. doi: 10.1371/journal.pone.0119571

PubMed Abstract | CrossRef Full Text | Google Scholar

Johnson, T. J., Bielak, E. M., Fortini, D., Hansen, L. H., Hasman, H., Debroy, C., et al. (2012). Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae. Plasmid 68, 43–50. doi: 10.1016/j.plasmid.2012.03.001

PubMed Abstract | CrossRef Full Text | Google Scholar

Kaase, M., Nordmann, P., Wichelhaus, T. A., Gatermann, S. G., Bonnin, R. A., and Poirel, L. (2011). NDM-2 carbapenemase in Acinetobacter baumannii from Egypt. J. Antimicrob. Chemother. 66, 1260–1262. doi: 10.1093/jac/dkr135

PubMed Abstract | CrossRef Full Text | Google Scholar

Khan, A. U., Maryam, L., and Zarrilli, R. (2017). Structure, genetics and worldwide spread of New Delhi Metallo-β-lactamase (NDM): a threat to public health. BMC Microbiol. 17:101. doi: 10.1186/s12866-017-1012-8

PubMed Abstract | CrossRef Full Text | Google Scholar

Krishnaraju, M., Kamatchi, C., Jha, A. K., Devasena, N., Vennila, R., Sumathi, G., et al. (2015). Complete sequencing of an IncX3 plasmid carrying blaNDM-5 allele reveals an early stage in the dissemination of the blaNDM gene. Indian J. Med. Microbiol. 33, 30–38. doi: 10.4103/0255-0857.148373

PubMed Abstract | CrossRef Full Text | Google Scholar

Lai, C. C., Chuang, Y. C., Chen, C. C., and Tang, H. J. (2017). Coexistence of MCR-1 and NDM-9 in a clinical carbapenem-resistant Escherichia coli isolate. Int. J. Antimicrob. Agents 49, 517–518. doi: 10.1016/j.ijantimicag.2017.02.001

PubMed Abstract | CrossRef Full Text | Google Scholar

Leverstein-Van, H. M. A., Stuart, J. C., Voets, G. M., Versteeg, D., Tersmette, T., and Fluit, A. C. (2010). Global spread of New Delhi metallo-β-lactamase 1. Lancet Infect. Dis. 10, 830–831. doi: 10.1016/S1473-3099(10)70277-2

CrossRef Full Text | Google Scholar

Li, X., Fu, Y., Shen, M., Huang, D., Du, X., Hu, Q., et al. (2018). Dissemination of blaNDM-5 gene via an IncX3-type plasmid among non-clonal Escherichia coli in China. Antimicrob. Resist. Infect. Control 7:59. doi: 10.1186/s13756-018-0349-6

PubMed Abstract | CrossRef Full Text | Google Scholar

Liang, W. J., Liu, H. Y., Duan, G. C., Zhao, Y. X., Chen, S. Y., Yang, H. Y., et al. (2017). Emergence and mechanism of carbapenem-resistant Escherichia coli in Henan, China, 2014. J. Infect. Public Health 11, 347–351. doi: 10.1016/j.jiph.2017.09.020

PubMed Abstract | CrossRef Full Text | Google Scholar

Liu, L., Feng, Y., McNally, A., and Zong, Z. (2018). blaNDM-21, a new variant of blaNDM in an Escherichia coli clinical isolate carrying blaCTX-M-55 and rmtB. J. Antimicrob. Chemother. 73, 2336–2339. doi: 10.1093/jac/dky226

PubMed Abstract | CrossRef Full Text | Google Scholar

Mei, Y. F., Liu, P. P., Wan, L. G., Liu, Y., Wang, L. H., Wei, D. D., et al. (2017). Virulence and genomic feature of a virulent Klebsiella pneumoniae sequence type 14 strain of serotype K2 harboring blaNDM-5 in China. Front. Microbiol. 8:335. doi: 10.3389/fmicb.2017.00335

PubMed Abstract | CrossRef Full Text | Google Scholar

Nordmann, P., and Poirel, L. (2014). The difficult-to-control spread of carbapenemase producers among Enterobacteriaceae worldwide. Clin. Microbiol. Infect. 20, 821–830. doi: 10.1111/1469-0691.12719

PubMed Abstract | CrossRef Full Text | Google Scholar

Otter, J. A., Burgess, P., Davies, F., Mookerjee, S., Singleton, J., Gilchrist, M., et al. (2017). Counting the cost of an outbreak of carbapenemase-producing Enterobacteriaceae: an economic evaluation from a hospital perspective. Clin. Microbiol. Infect. 23, 188–196. doi: 10.1016/j.cmi.2016.10.005

PubMed Abstract | CrossRef Full Text | Google Scholar

Pereira, P. S., Borghi, M., de Araújo, C. F., Aires, C. A., Oliveira, J. C., Asensi, M. D., et al. (2015). Clonal Dissemination of OXA-370-producing Klebsiella pneumoniae in Rio de Janeiro, Brazil. Antimicrob. Agents Chemother. 59, 4453–4456. doi: 10.1128/AAC.04243-14

PubMed Abstract | CrossRef Full Text | Google Scholar

Pérez-Pérez, F. J., and Hanson, N. D. (2002). Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 40, 2153–2162. doi: 10.1128/JCM.40.6.2153-2162.2002

PubMed Abstract | CrossRef Full Text | Google Scholar

Poirel, L., Héritier, C., Tolün, V., and Nordmann, P. (2004). Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 48, 15–22. doi: 10.1128/AAC.48.1.15-22.2004

PubMed Abstract | CrossRef Full Text | Google Scholar

Queenan, A. M., Torres-Viera, C., Gold, H. S., Carmeli, Y., Eliopoulos, G. M., Moellering, R. C., et al. (2000). SME-type carbapenem-hydrolyzing class A beta-lactamases from geographically diverse Serratia marcescens strains. Antimicrob. Agents Chemother. 44, 3035–3039. doi: 10.1128/AAC.44.11.3035-3039.2000

PubMed Abstract | CrossRef Full Text | Google Scholar

Rahman, M., Mukhopadhyay, C., Rai, R. P., Singh, S., Gupta, S., Singh, A., et al. (2018). Novel variant NDM-11 and other NDM-1 variants in multidrug-resistant Escherichia coli from South India. J. Glob. Antimicrob. Resist. 14, 154–157. doi: 10.1016/j.jgar.2018.04.001

PubMed Abstract | CrossRef Full Text | Google Scholar

Rahman, M., Shukla, S. K., Prasad, K. N., Ovejero, C. M., Pati, B. K., Tripathi, A., et al. (2014). Prevalence and molecular characterisation of New Delhi metallo-β-lactamases NDM-1, NDM-5, NDM-6 and NDM-7 in multidrug-resistant Enterobacteriaceae from India. Int. J. Antimicrob. Agents 44, 30–37. doi: 10.1016/j.ijantimicag.2014.03.003

PubMed Abstract | CrossRef Full Text | Google Scholar

Schmitt, J., Jacobs, E., and Schmidt, H. (2007). Molecular characterization of extended-spectrum beta-lactamases in Enterobacteriaceae from patients of two hospitals in Saxony, Germany. J. Med. Microbiol. 56(Pt 2), 241–249. doi: 10.1099/jmm.0.46670-0

PubMed Abstract | CrossRef Full Text | Google Scholar

Senda, K., Arakawa, Y., Ichiyama, S., Nakashima, K., Ito, H., Ohsuka, S., et al. (1996). PCR detection of metallo-beta-lactamase gene (blaIMP) in gram-negative rods resistant to broad-spectrum beta-lactams. J. Clin. Microbiol. 34, 2909–2913.

PubMed Abstract | Google Scholar

Stewart, A. C., Bethel, C. R., VanPelt, J., Bergstrom, A., Cheng, Z., Miller, C. G., et al. (2017). Clinical variants of New Delhi metallo-β-lactamase are evolving to overcome zinc scarcity. ACS Infect. Dis. 3, 927–940. doi: 10.1021/acsinfecdis.7b00128

PubMed Abstract | CrossRef Full Text | Google Scholar

Torres-González, P., Bobadilla-Del Valle, M., Tovar-Calderón, E., Leal-Vega, F., Hernández-Cruz, A., Martínez-Gamboa, A., et al. (2015). Outbreak caused by Enterobacteriaceae harboring NDM-1 metallo-β-lactamase carried in an IncFII plasmid in a tertiary care hospital in Mexico City. Antimicrob. Agents Chemother. 59, 7080–7083. doi: 10.1128/AAC.00055-15.

PubMed Abstract | CrossRef Full Text | Google Scholar

Wailan, A. M., Paterson, D. L., Caffery, M., Sowden, D., and Sidjabat, H. E. (2015). Draft genome sequence of NDM-5-producing Escherichia coli sequence Type 648 and genetic context of blaNDM-5 in Australia. Genome. Announc. 3:e00194–15. doi: 10.1128/genomeA.00194-15

PubMed Abstract | CrossRef Full Text | Google Scholar

Walsh, T. R. (2010). Emerging carbapenemases: a global perspective. Int. J. Antimicrob. Agents 36(Suppl. 3), S8–S14. doi: 10.1016/S0924-8579(10)70004-2

PubMed Abstract | CrossRef Full Text | Google Scholar

Wang, L. H., Liu, P. P., Wei, D. D., Liu, Y., Wan, L. G., Xiang, T. X., et al. (2016). Clinical isolates of uropathogenic Escherichia coli ST131 producing NDM-7 metallo-β-lactamase in China. Int. J. Antimicrob. Agents 48, 41–45. doi: 10.1016/j.ijantimicag.2016.03.009

PubMed Abstract | CrossRef Full Text | Google Scholar

Wang, S., Zhao, S. Y., Xiao, S. Z., Gu, F. F., Liu, Q. Z., Tang, J., et al. (2016). Antimicrobial resistance and molecular epidemiology of Escherichia coli causing bloodstream infections in three hospitals in Shanghai, China. PLoS ONE 11:e0147740. doi: 10.1371/journal.pone.0147740

PubMed Abstract | CrossRef Full Text | Google Scholar

Wang, X., Xu, X., Li, Z., Chen, H., Wang, Q., Yang, P., et al. (2014). An outbreak of a nosocomial NDM-1-producing Klebsiella pneumoniae ST147 at a teaching hospital in mainland China. Microb. Drug Resist. 20, 144–149. doi: 10.1089/mdr.2013.0100

PubMed Abstract | CrossRef Full Text | Google Scholar

Wirth, T., Falush, D., Lan, R., Colles, F., Mensa, P., Wieler, L. H., et al. (2006). Sex and virulence in Escherichia coli: an evolutionary perspective. Mol. Microbiol. 60, 1136–1151. doi: 10.1111/j.1365-2958.2006.05172.x

PubMed Abstract | CrossRef Full Text | Google Scholar

Yamamoto, M., and Pop-Vicas, A. E. (2014). Treatment for infections with carbapenem-resistant Enterobacteriaceae: what options do we still have? Crit. Care 18:229. doi: 10.1186/cc13949

PubMed Abstract | CrossRef Full Text | Google Scholar

Yang, J., Chen, Y., Jia, X., Luo, Y., Song, Q., Zhao, W., et al. (2012). Dissemination and characterization of NDM-1-producing Acinetobacter pittii in an intensive care unit in China. Clin. Microbiol. Infect. 18, E506–E513. doi: 10.1111/1469-0691.12035

PubMed Abstract | CrossRef Full Text | Google Scholar

Yang, P., Xie, Y., Feng, P., and Zong, Z. (2014). blaNDM-5 carried by an IncX3 plasmid in Escherichia coli sequence type 167. Antimicrob. Agents Chemother. 58, 7548–7552. doi: 10.1128/AAC.03911-14

PubMed Abstract | CrossRef Full Text | Google Scholar

Yong, D., Toleman, M. A., Giske, C. G., Cho, H. S., Sundman, K., Lee, K., et al. (2009). Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob. Agents Chemother. 53, 5046–5054. doi: 10.1128/AAC.00774-09

PubMed Abstract | CrossRef Full Text | Google Scholar

Yu, J., Tan, K., Rong, Z., Wang, Y., Chen, Z., Zhu, X., et al. (2016). Nosocomial outbreak of KPC-2- and NDM-1-producing Klebsiella pneumoniae in a neonatal ward: a retrospective study. BMC Infect. Dis. 16:563. doi: 10.1186/s12879-016-1870-y

PubMed Abstract | CrossRef Full Text | Google Scholar

Yu, Y., Ji, S., Chen, Y., Zhou, W., Wei, Z., Li, L., et al. (2007). Resistance of strains producing extended-spectrum beta-lactamases and genotype distribution in China. J. Infect. 54, 53–57. doi: 10.1016/j.jinf.2006.01.014

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhang, F., Xie, L., Wang, X., Han, L., Guo, X., Ni, Y., et al. (2016). Further spread of blaNDM-5 in Enterobacteriaceae via IncX3 plasmids in Shanghai, China. Front. Microbiol. 7:424. doi: 10.3389/fmicb.2016.00424

CrossRef Full Text | Google Scholar

Zhang, R., Liu, L., Zhou, H., Chan, E. W., Li, J., Fang, Y., et al. (2017). Nationwide surveillance of clinical Carbapenem-resistant Enterobacteriaceae (CRE) strains in China. EBioMedicine 19, 98–106. doi: 10.1016/j.ebiom.2017.04.032

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhang, Y., Wang, Q., Yin, Y., Chen, H., Jin, L., Gu, B., et al. (2018). Epidemiology of carbapenem-resistant Enterobacteriaceae infections: report from the China CRE network. Antimicrob. Agents Chemother. 62. doi: 10.1128/AAC.01882-17

PubMed Abstract | CrossRef Full Text | Google Scholar

Zilberberg, M. D., and Shorr, A. F. (2013). Secular trends in gram-negative resistance among urinary tract infection hospitalizations in the United States, 2000-2009. Infect. Control Hosp. Epidemiol. 34, 940–946. doi: 10.1086/671740

PubMed Abstract | CrossRef Full Text | Google Scholar