ORIGINAL RESEARCH article

Front. Immunol., 15 January 2020

Sec. T Cell Biology

Volume 10 - 2019 | https://doi.org/10.3389/fimmu.2019.03048

DGK α and ζ Activities Control TH1 and TH17 Cell Differentiation

  • 1. Division of Allergy and Immunology, Department of Pediatrics, Duke University Medical Center, Durham, NC, United States

  • 2. Department of Microbiology, Immunology, and Cell Biology, West Virginia University School of Medicine, Morgantown, WV, United States

  • 3. Department of Neuroscience, West Virginia University School of Medicine, Morgantown, WV, United States

  • 4. Department of Immunology, Duke University Medical Center, Durham, NC, United States

  • 5. Hematologic Malignancies and Cellular Therapies Program, Duke Cancer Institute, Duke University Medical Center, Durham, NC, United States

Abstract

CD4+ T helper (TH) cells are critical for protective adaptive immunity against pathogens, and they also contribute to the pathogenesis of autoimmune diseases. How TH differentiation is regulated by the TCR's downstream signaling is still poorly understood. We describe here that diacylglycerol kinases (DGKs), which are enzymes that convert diacylglycerol (DAG) to phosphatidic acid, exert differential effects on TH cell differentiation in a DGK dosage-dependent manner. A deficiency of either DGKα or ζ selectively impaired TH1 differentiation without obviously affecting TH2 and TH17 differentiation. However, simultaneous ablation of both DGKα and ζ promoted TH1 and TH17 differentiation in vitro and in vivo, leading to exacerbated airway inflammation. Furthermore, we demonstrate that dysregulation of TH17 differentiation of DGKα and ζ double-deficient CD4+ T cells was, at least in part, caused by increased mTOR complex 1/S6K1 signaling.

Introduction

CD4+ T helper (TH) cells play a central role in orchestrating adaptive immune response to pathogens and also contribute to autoimmune diseases (1, 2). After antigen stimulation, naïve CD4+ T cells differentiate into discrete subsets of effector TH cells with distinct functions and cytokine profiles. Interferon-γ (IFN-γ)-producing TH1 cells, induced by IL-12 and directed by transcriptional factor T-bet, are critical for the clearance of intracellular pathogens (3, 4). TH2 cells, which secrete IL-4, IL-5, and IL-13 and are controlled by GATA-3, are crucial for protection against parasites and extracellular pathogens (5, 6). TH17 cells produce IL-17A, IL-17F, and IL-22, and play an important role in the control of specific pathogens such as fungi. TH17 differentiation is driven by a combination of TGF-β and IL-6 and requires transcriptional factor RORγt and RORα. IL-23 promotes TH17 responses by enhancing their survival and stabilization (712).

Despite their importance in host immunity against pathogens, TH cells can be pathogenic and contribute to various diseases. Both exaggerated and defective TH1 response has been linked to the induction of autoimmune diseases (1315). TH2 cells contribute to allergies and asthma (16, 17). TH17 cells are associated with many autoimmune and inflammatory diseases such as psoriasis, inflammatory bowel diseases, rheumatoid arthritis, type 1 diabetes, and multiple sclerosis (8, 11, 1820). Thus, understanding how TH responses are regulated is important to manipulate immune responses, to improve host defense against microbial infection, and to treat autoimmune diseases.

Engagement of the TCR on naïve CD4+ T cells is essential for their activation and further differentiation to TH cells (21, 22). Evidence has revealed that TCR signal strength and downstream signaling pathways as well as cytokine and costimulatory signals shape TH lineage differentiation (2326). A critical event after TCR engagement is the generation of the second messenger diacylglycerol (DAG) by activated PLCγ1. DAG associates with and allosterically activates RasGRP1 and PKCθ, leading to the activation of the Ras-Erk1/2-AP1 and PKCθ-IKK-NFκB signaling pathways, respectively, and is indispensable for T cell activation (2730). Since it has been demonstrated that both Ras- and PKCθ-mediated signal cascades are involved in TH differentiation (3134), it is important to investigate if DAG concentrations should be tightly controlled during TH differentiation.

DAG kinases (DGKs), a family of enzymes that catalyze phosphorylation of DAG to generate phosphatidic acid (PA), are employed to inhibit DAG-mediated signaling following TCR engagement in both thymocytes and peripheral T cells (2830). DGKα and ζ, isoforms that express at high levels in T cells, have been demonstrated to inhibit the activation of both Ras-Erk and PKCθ-NFκB cascades as well as mTOR signaling (3537). They regulate conventional αβT cell, iNKT cell, mucosal associated invariant T cell, and regulatory T cell development, negatively control T cell activation, regulate CD8 T cell mediated anti-viral responses and activation induced T cell death, promote T cell anergy, and inhibit anti-tumor responses (27, 3855). However, the role of DGKs in TH differentiation is unknown. We report here that a deficiency of either DGKα or ζ selectively impairs TH1 cell differentiation, but the loss of both DGK isoforms enhances CD4+ naïve T cells differentiating into TH1 and TH17 in vitro and in vivo, establishing DGK activity as a critical regulator of effector CD4+ T cell differentiation.

Materials and Methods

Mice

DGKα−/−, DGKζ−/−, and ERCre mice were generated as previously described (38, 39, 56). DGKζf/f mice were generated by introducing two LoxP sites that flank exons 10–14 of the Dgkz locus (57). TCR transgenic OT2 mice were purchased from the Jackson Laboratory and were cross-bred with DGKα−/−ζf/f ERCre mice to generate DGKα−/−ζf/f OT2 ERCre mice in specific pathogen-free facilities at Duke University Medical Center. The experiments in this study were performed according to a protocol approved by the Institutional Animal Care and Usage Committee of Duke University. DGKα−/−ζf/f or DGKα−/−ζf/f OT2 ERCre mice were intraperitoneally injected with tamoxifen (100 mg/kg body weight) on the first, second, and fifth day to delete DGKζ, and mice were then euthanized for experiments on the eighth day.

Reagents and Antibodies

Iscove's modified Dulbecco's medium (IMDM) was supplemented with 10% (vol/vol) FBS, penicillin/streptomycin, and 50 μM 2-mercaptoethanol (IMDM-10). Fluorescence-conjugated anti-mouse antibodies CD4 (GK1.5), TCRVα2 (B20.1), CD44 (IM7), CD62L (MEL-14), Thy1.1 (OX-7), Thy1.2 (58-2.1), T-bet (4B10), IFN-γ (XMG1.2), IL-4 (11B11), IL-17A (TC11-18H10.1), and IL-17F (9D3.1C8) were purchased from BioLegend; anti-mouse antibodies for RORγt (AFKJS-9) and Foxp3 (FJK-16s) were purchased from eBioscience. Cell death was determined by Live/Dead Fixable Violet Dead Cell Stain (Invitrogen).

Flow Cytometry

Standard protocols were used to prepare single cell suspensions from the spleen and lymph nodes of mice (in IMDM containing 10% FBS and antibiotics). Red blood cells were lysed using an ACK buffer. Samples were subsequently stained with antibodies in PBS containing 2% FBS and collected on a BD FACSCanto II cytometer. Intracellular staining for T-bet and RORγt was performed using the eBioscience Foxp3 Staining Buffer Set. Intracellular staining for IFNγ, IL-4, IL-17A, and IL-17F was performed using the BD Biosciences Cytofix/Cytoperm and Perm/Wash solutions.

In vitro TH Differentiation

CD4+ T cells were purified from the spleen and LN with anti-CD4 microbeads (Miltenyi Biotec) and then were further sorted as naïve CD4+CD62LhiCD44loCD25. Sorted cells were activated with plate-bound anti-CD3 (5 μg/ml, 1452C11, Bio Xcell) and soluble anti-CD28 (1 μg/ml, PV1, BioXcell) for 4–5 days with various combinations of cytokines and antibodies. For the non-polarizing (TH0) condition, naïve cells were cultured in the presence of hIL-2 (100 U/ml, Peprotech). For the TH1 condition, naïve cells were cultured with hIL-2 (100 U/ml), mIL-12 (20 ng/ml, Peprotech), and anti-mIL4 (10 μg/ml, 11B11, Bio Xcell) for 4 days. For the TH2 condition, naïve cells were polarized in the presence of hIL-2 (100 U/ml), mIL-4 (20 ng/ml, Peprotech), and anti-IFNγ (10 μg/ml, XMG1.2, BioXcell) for 5 days. For the TH17 condition, naïve cells were cultured with hTGF-β1 (5 ng/ml, Peprotech), mIL-6 (25 ng/ml, Peprotech), anti-mIL4 (10 μg/ml), and anti-IFNγ (10 μg/ml) for 4 days. For iTreg induction, 100 U/ml of hIL-2 and 1 ng/ml TGFβ (Peprotech) were included in the culture for 4 days, followed by intracellular Foxp3 staining. To assess proliferation, sorted naïve CD4+ T cells were labeled with CellTrace™ Violet (CTV, ThermoFisher) before cultured in different polarization conditions. For the inhibition assay, 10 μM S6K inhibitor (PF-4708671, Sigma) and 1 nM rapamycin were added to the TH1 and TH17 polarizing conditions at the beginning of culture, and cells were cultured for 4 days. At the end of polarizing, cells were stimulated with PMA (50 ng/ml) and ionomycin (500 ng/ml) in the presence of GolgiPlug (1 ng/ml) for 4–5 h. This was followed by cell surface and intracellular staining for appropriated cytokines.

Adoptive Transfer, Immunization, and Airway Inflammation

TCRVα2+ cells from splenocytes and LN cells for TCR OTII transgenic mice were enriched using MACS magnetic beads and Miltenyi Biotec LS columns. About 100 million cells in 500 μl of IMDM-10 were incubated with the PE-TCRVα2 antibody (1:100 dilution) and then with anti-PE magnetic beads to isolate TCRVα2+ cells according to the manufacturer's protocol. Enriched samples were stained with anti-CD4, −CD44, and −CD62L antibodies and sorted on a MoFlo Astrios sorter to obtain viable CD4+TCRVα2+CD44CD62L+ naïve OT2 T cells. Naïve WT or DGKα−/−ζf/f OT2 cells (Thy1.1Thy1.2+, 1.5 × 106 cell/mouse) were intravenously injected into sex-matched recipients (Thy1.1+Thy1.2+). Recipient mice were immunized by subcutaneous injection in the inguinal region with 100 μg/mouse OVA323−339 peptide emulsified in the CFA 24 h after adoptive transfer and were euthanized to harvest the spleen and drain inguinal lymph nodes on the seventh day after immunization. Splenocytes and dLN cells were stimulated with PMA and ionomycin in the presence of GolgiPlug for 4–5 h or stimulated with 10 μg/ml OVA323−339 for 2 days in the presence of 1 ng/ml GolgiPlug in the last 5 h. Cell surface and intracellular staining for appropriated cytokines were subsequently performed.

For airway inflammation, OTII T cell recipient mice were intranasally injected with 25 μl of 2.5 mg/ml OVA323−339 peptide in PBS daily for 3 consecutive days starting 24 h after adoptive transfer. Mice were euthanized on the eighth day after adoptive transfer for collection of BALF. Lungs were fixed in 10% formalin and thin-sectioned for hematoxylin and eosin (H&E) staining. Spleen and draining mediastinal LNs were harvested for cytokine analysis.

ELISA

Cultured supernatant or BALF samples were appropriately diluted and IFNγ, IL-4, and IL-17A concentrations were determined using Mouse ELISA max kits (BioLegend) according to the manufacturer's instructions.

Real-Time RT-PCR

Cells were lysed in Trizol for RNA preparation. The first strand cDNA was made using the iScript Select cDNA Synthesis Kit (Biorad). Real-time quantitative PCR was conducted using Eppendorf realplex2. Expressed levels of target mRNAs were normalized with β-actin and calculated using the 2−ΔΔCT method. Primers used in this study are listed as following: DGKα Forward: GATGCAGGCACCCTGTACAAT, Reverse: GGACCCATAAGCATAGGCATCT; DGKζ Forward: CGGCTGCCTGGTGTAGACA, Reverse: GCACCTCCAGAGATCCTTGATG; IFN-γ Forward: GCGTCATTGAATCACACCTG, Reverse: TGAGCTCATTGAATGCTTGG; IL-4 Forward: ACAGGAGAAGGGACGCCA, Reverse: GAAGCCCTACAGACGAGCTCA; IL-17A Forward: GCTCCAGAAGGCCCTCAGA, Reverse: CTTTCCCTCCGCATTGACA; Tbx21 Forward: GGTGTCTGGGAAGCTGAGAG, Reverse: GAAGGACAGGAATGGGAACA; GATA-3 Forward: AACCACGTCCCGTCCTACTA, Reverse: AGAGATCCGTGCAGCAGA; RORc Forward: CGACTGGAGGACCTTCTACG, Reverse: TTGGCAAACTCCACCACATA; RORα Forward: CCATGCAAGATCTGTGGAGA, Reverse: CAGGAGTAGGTGGCATTGCT; β-actin Forward: TGTCCACCTTCCAGCAGATGT, Reverse: AGCTCAGTAACAGTCCGCCTAGA.

Western Blot Analysis

In vitro-cultured TH cells were lysed in lysis buffer (1% Nonidet P-40, 150 mM NaCl, 50 mM Tris, pH 7.4) with freshly added protease and phosphatase inhibitors. Samples were subjected to immunoblotting analysis, and probed with anti-pS6 (S235/236), -pErk1/2, -total S6, -total Erk1/2, and β-actin antibodies (Cell Signaling Technology).

Statistical Analysis

Data are presented as mean ± SEM, and statistical significance was determined by two-tailed Student's t-test. The p-values are defined as follows: *p < 0.05, **p < 0.01, ***p < 0.001.

Results

Deficiency of Either DGKα or ζ Impaired TH1 Cell Differentiation

DGKα and ζ are dynamically regulated during T cell development and activation (27, 35, 39, 40). We found that DGKα mRNA was decreased in TH0, TH1, TH2, TH17, and iTregs compared with naïve CD4+ T cells. DGKζ mRNA also was decreased in TH0, TH1, and TH17 cells but not in TH2 and iTregs compared with naïve CD4+ T cells (Figure 1A). Both DGKα and ζ appeared more significantly down-regulated in TH1 and TH17 conditions than in TH0 condition. To examine the role of DGKα and ζ in TH differentiation, WT, DGKα−/−, and DGKζ−/− CD44CD62L+ naïve CD4+ T cells were cultured in TH1, TH2, and TH17 polarization conditions in vitro for 4–5 days. DGKα−/− or DGKζ−/− CD4+ T cells displayed impaired differentiation to TH1 cells, which was indicated by decreases of IFN-γ+ cells in both percentages and numbers (Figures 1B,C), IFN-γ concentration in culture supernatants (Figure 1F), and IFN-γ mRNA levels (Figure 1G), accompanying the decreased expression of T-bet (Figure 1H). However, total CD4+ T cells numbers were increased in the absence of either DGKα or ζ during TH1 polarization (Figure 1C), suggesting that impaired TH1 differentiation of DGKα−/− or DGKζ−/− CD4+ T cells did not result from decreased expansion. In contrast, TH2 and TH17 differentiation was not obviously affected by DGKα or ζ deficiency. This was reflected by similar percentages of IL-4+ or IL-17+ cells (Figures 1B,D,E) and similar levels of IL-4 or IL-17A proteins in culture supernatants (Figure 1F) and mRNAs (Figure 1G), which correlated with comparable expression of GATA-3 or RORγt (Figure 1H). Both DGKα−/− CD4+ T cells and DGKζ−/− CD4+ T cells displayed slightly improved survival under the TH1 condition and had similar survival rates under TH2 and TH17 conditions (Figure 1I), suggesting that their reduced TH1 responses were not due increased cell death. Together, these data suggested individual DGKα and DGKζ are required for TH1 differentiation, but are dispensable for TH2 and TH17 development in vitro.

Figure 1

Deficiency of Both DGKα and ζ Promoted TH1 and TH17 Differentiation

DGKα and ζ promote T cell and iNKT cell maturation synergistically in the thymus (52, 54). To determine if DGKα and ζ exert a synergistic role during TH differentiation, we generated DGKα−/−ζf/f-ERCre (DKO) mice so that both DGKα and ζ were ablated after tamoxifen-induced deletion of DGKζ. In contrast to DGKα or ζ single-knockout T cells, DKO CD4+ naïve T cells showed enhanced capacity to differentiate into both TH1 and TH17 cells but similar TH2 differentiation compared with their WT counterparts (Figures 2A,B), coinciding with increased IFN-γ and IL-17A but not IL-4 concentration in culture supernatants (Figure 2C) and IFN-γ and IL-17A mRNA levels in these cells (Figure 2D). DKO CD4+ T cells displayed slightly decreased survival rate under TH1 but similar survival rate under TH17 polarization conditions, suggesting that their enhanced TH1 and TH17 responses were not due to improved survival (Figure 2E). However, under both TH1 and TH17 conditions, DKO CD4+ T cells proliferated more vigorously than WT controls, which might contribute to their enhanced TH1 and TH17 responses (Figure 2F). In contrast to TH1 and TH17 differentiation, iTreg cell induction was not obviously different between WT and DKO naïve CD4+ T cells (WT iTreg percentages: 62.49 ± 9.186 n = 7; DKO iTreg percentages: 53.84 ± 8.465 n = 7; P = 0.5022). Together, these results indicated that deficiency of both DGKα and ζ promoted TH1 and TH17 differentiation with minimal effects on TH2 or iTreg cell differentiation in vitro.

Figure 2

Loss of Both DGKα and ζ Prompted TH1 and TH17 Differentiation in vivo

To further determine the impact of DGKα and ζ double deficiency on TH differentiation in vivo, we generated DKO mice carrying the OT2 TCR transgene, which recognizes chicken ovalbumin peptide 323-339 (OVA323−339) in the context of I-Ab (58) and adoptively transferred WT- or DKO-naïve OT2 T cells (Thy1.1Thy1.2+CD4+TCRVα2+) into congenic Thy1.1+Thy1.2+ recipients. Recipient mice were immunized with OVA323−339 peptide emulsified in complete Freund's adjuvant (CFA) 1 day after the transfer. Seven days after immunization, donor-derived DKO OT2 T cells were increased in both percentages and numbers in the spleen and draining lymph nodes (dLNs) compared with WT controls (Figures 3A–C). In addition, higher percentages of DKO OT2 T cells expressed IFN-γ, IL-17A, and IL-17F than WT controls following in vitro PMA and ionomycin stimulation for 4 h (Figures 3D–F). Because of increased DKO OT2 T cell numbers, DKO OT2 TH1 and TH17 cell numbers were much greater than WT controls in dLNs and particularly in the spleen (Figures 3G,H). Moreover, DKO OT2 T cells contained more IFN-γ-, IL-17A-, and IL-17F-positive cells, which was detected by intracellular staining (Figures 3I,J), and secreted more cytokines to culture supernatants, which was detected by ELISA (Figures 3K,L), than their WT controls following stimulation with OVA323−339 peptide for 2 days. Together, these results demonstrated that the deficiency of both DGKα- and ζ-enhanced TH1 and TH17 polarization and expansion in vivo via cell intrinsic mechanisms.

Figure 3

Accumulation of TH1 and TH17 Cells in the Absence of DGKα and ζ Caused Severe Airway Inflammation

TH17 cells promote airway inflammation and hyper-responsiveness via recruiting neutrophils and induce airway smooth muscle contraction, which contributes to the severe form of asthma (59, 60). To determine if dysregulated TH responses of DKO CD4+ T cells impact airway inflammation, we adoptively transferred naïve WT and DKO OT2 cells (Thy1.2+) into WT Thy1.1+Thy1.2+ congenic mice on day −1 and then intranasally injected OVA323−339 peptide into the recipient mice on days 0, 1, and 2. On the seventh day, we detected at least four-fold more DKO OT2 cells in both percentages and numbers in the draining mediastinal lymph nodes and spleen in recipient mice than their WT counterparts (Figures 4A–C). DKO donor-derived OT2 cells in both dLNs and spleens produced more IL-17A and IL-17F as well as IFN-γ in response to in vitro stimulation with PMA and ionomycin for 4 h (Figures 4D–H) or with OVA323−339 peptide for 2 days (Figures 4I–M). Concordantly, both IFN-γ and IL-17A levels in bronchoalveolar lavage fluid (BALF) were elevated in recipients with DKO OT2 T cells compared with those with WT OT2 T cells (Figure 5A). Moreover, DKO OT2 cell recipients contained more neutrophils and lymphocytes than those with WT control in BALF (Figures 5B,C) and in interstitial lung tissues that surround the bronchioles (Figure 5D). Together, these results demonstrated that DGKα and ζ deficiencies in CD4+ T cells exacerbated airway inflammation, likely as a result of enhanced TH17 responses to protein allergens.

Figure 4

Figure 5

Effects of DGKαζ Double Deficiency on Expression of Critical Lineage Transcription Factors

T-bet, GATA-3, RORγt, and RORα are transcription factors that play critical roles in TH1, TH2, and TH17 differentiation, respectively. Under the TH1 polarization condition, DKO CD4+ T cells expressed higher levels of T-bet at both mRNA and protein levels than WT controls (Figures 6A,B), which was consistent with their elevated TH1 responses. In contrast, GATA-3 expression in DKO CD4+ T cells was not obviously different from WT controls under the TH2 polarization condition (Figure 6C), consistent with a minimal effect of DKO on TH2 responses as shown in Figure 2. Interestingly, Rorc (gene encoding RORγt) mRNA levels were obviously decreased in DKO CD4+ T cells under the TH17 polarization condition (Figure 6D), although RORγt protein was only slightly decreased (Figure 6E). In contrast, RORa mRNA levels were increased in DKO CD4+ T cells 24 and 36 h after polarization (Figure 6F). Both RORα and RORγt are important for TH17 differentiation and RORγt is considered the master regulator of the Th17 lineage (6163). It is intriguing that DGKα and ζ double deficiency enhanced Th17 differentiation yet downregulated RORγt expression. Increased RORα expression in DKO CD4+ T cells might partially compensate for the decrease of RORγt. Additionally, DGKαζ deficiency might alleviate the requirement of RORγt and promote TH17 differentiation via other mechanisms.

Figure 6

Effects of DGKα and ζ Double Deficiency on mTORC1/S6K1 Signaling During TH1 and TH17 Cell Differentiation

DGKα and ζ negatively control DAG-mediated Ras-Erk1/2 activation in thymocytes and naïve T cells following TCR engagement (36, 38, 54). We further examined how DGKα and ζ double deficiency might affect this pathway during TH polarization. As shown in Figure 7A, Erk1/2 phosphorylation was obviously enhanced in DKO CD4+ T cells under TH0, TH1, TH2, and TH17 conditions, suggesting that DGKα and ζ negatively controlled Erk1/2 activation during effector CD4+ T cell differentiation. Previous studies have found that DAG-mediated RasGRP1-Ras-Erk, PI3K-Akt, and PKCθ-CARMA1 pathways participate in TCR-induced mTORC1 activation and DGKα and ζ double deficiency but not DGKα or ζ single deficiency leads to enhanced mTOR signaling in developing thymocytes (36, 64, 65) and that mTOR plays important roles in Th differentiation (6569). Although, S6 phosphorylation, an mTORC1/S6K1-dependent event, in TH1 cells appeared unaffected by DGKα and ζ double deficiency, it was obviously increased in DKO CD4+ T cells under TH0, TH2, and TH17 polarization conditions, suggesting that DGKα and ζ negatively controlled mTORC1 signaling in TH0, TH2, and TH17 cells. Treatment of WT and DKO CD4+ T cells with either rapamycin or the S6K1 inhibitor PF-4708671 caused about 50% reduction of IFNγ+ cells in both cell types but DKO CD4+ T cells still contained higher percentages of IFNγ+ cells than WT controls. Thus, DKO CD4+ T cells were partially sensitive to mTORC1/S6K1 inhibition (Figures 7B,C), suggesting that additional mechanisms might contribute to enhanced TH1 differentiation in these cells. In contrast, TH17 differentiation of both DKO and WT CD4+ T cells was potently inhibited by either rapamycin or PF-4708671 (Figures 7D,E). Although, we could not rule out potential off-target effects of PF-4708671 and rapamycin, our data suggested that enhanced mTORC1/S6K1 signaling might contribute to the elevated TH17 responses of DKO CD4+ T cells.

Figure 7

Discussion

Previous studies have demonstrated that DGKα and ζ play crucial roles in T cell development, activation, anergy, and survival, and CD8 T cell-mediated anti-viral immune responses, iNKT cell development, regulatory T cell differentiation, and anti-tumor immune responses (27, 3854). Additionally, DGKζ has been found to regulate B cell development (70), mast cell activation (71), TLR-mediated innate immunity (72), and NK cells (73). In this study, we have demonstrated that graded DGK activities differentially control CD4+ TH differentiation. Although, the absence of either DGKα or ζ selectively impairs TH1 differentiation, simultaneous ablation of both DGKα and ζ enhances both TH1 and TH17 responses in vitro and in vivo.

Recent studies have demonstrated that mTOR signaling plays a critical role in T cell activation and TH differentiation. mTORC1 promotes TH1, TH2, and TH17 differentiation while mTORC2 activity is indispensable for TH2 cells development (6567). Among different effector CD4+ T cells, TH1 cells appear to possess the highest S6 phosphorylation and, thus, mTORC1 activity. Although, S6 phosphorylation is not increased in DKO TH1 cells, elevated DKO TH1 response is substantially decreased when mTORC1-S6K1 signaling is inhibited, suggesting that enhanced DKO TH1 response is at least in part via enhanced mTORC1-S6K1 signaling. Different from TH1 cells, DKO TH0, TH2, and TH17 cells contain elevated S6 phosphorylation, and inhibition of either mTORC1 or S6K1 reverts their elevated TH17 responses. Our study suggested a linkage between DGKs and mTORC1/S6K1 in the regulation of TH17 cell differentiation. In thymocytes, T cell line models, and primary T cells, both RasGRP1-Ras-Erk1/2 and PKCθ-CARMA1 pathways signal to promote mTORC1 activation (36, 64). Although, it remains to be defined, DGKα and ζ may inhibit mTORC1/S6K1 signaling via modulating these DAG-mediated signaling pathways during effector CD4+ T cell differentiation. In addition to S6K1, many other molecules and pathways that play important roles in TH differentiation are regulated by mTOR (65, 68, 69, 7477). Future studies should investigate whether DGKα and ζ may regulate TH differentiation through other mechanisms.

Dysregulated TH1 and TH17 responses contribute to the pathogenesis of numerous autoimmune diseases, including psoriasis, inflammatory bowel disease, rheumatoid arthritis, type 1 diabetes, multiple sclerosis, experimental autoimmune encephalomyelitis, and neutrophil-related airway inflammation (8, 11, 1315, 1820). We have shown that dysregulated TH1 and TH17 responses in the absence of DGKα and ζ are pathogenic, indicated by exacerbated neutrophil-related airway inflammation. Interestingly, DGKα and ζ double deficiency leads to a loss of T cell tolerance and the development of autoimmune diseases in mice (manuscript in preparation). Enhanced CD4+ T cell effector function might be an important contributor to the development of autoimmune diseases in these mice. Thus, modulating DGKα and ζ activity could be a potential strategy to shape immune responses. Of note, although DGKα and ζ double deficiency does not obviously affect iTreg induction in vitro, our data do not rule out a potential role of DGK activity in peripheral Treg induction from naïve CD4+ T cells in vivo. Additional studies are needed to determine whether DGKα and ζ play a redundant role in Treg cells.

In summary, DGK activity plays selective roles in TH cell differentiation. A single knockout of DGKα or ζ impaired TH1 cell differentiation whereas a deficiency of both DGKα and ζ promoted TH1 and TH17 cell differentiation in vitro and in vivo. Such dysregulated expansion of both TH cells in the absence of DGKα and ζ caused severe airway inflammation. DGKα and ζ double deficiency led to enhanced mTORC1-S6K1 activation during TH17 cell differentiation, which may contribute to enhanced TH17 cell differentiation. Our study demonstrated the role of DGKs in TH cell differentiation and provides useful evidence for these enzymes as potential targets for therapeutic approaches of autoimmune diseases associated with the dysregulation of TH1 and TH17 cells.

Statements

Data availability statement

All datasets generated for this study are included in the article/supplementary material.

Ethics statement

The experiments in this study were performed according to a protocol approved by the Institutional Animal Care and Usage Committee of Duke University.

Author contributions

JY designed and performed experiments, analyzed data, and wrote the paper. H-XW, JX, LL, and JW performed experiments and analyzed data. EW generated critical reagents. X-PZ conceived the project, designed experiments, participated in data analysis, and wrote the paper.

Funding

This study was supported by the National Institutes of Health (R01AI079088, R01AI101206, and R56AG060984).

Acknowledgments

We thank the Transgenic and Knockout Mice Facility and the Flow Cytometry Core Facility at Duke Cancer Institute for generating DGKζf/+ mice and providing sorting service, respectively.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  • 1.

    MurphyKMReinerSL. The lineage decisions of helper T cells. Nat Rev Immunol. (2002) 2:93344. 10.1038/nri954

  • 2.

    ZhuJYamaneHPaulWE. Differentiation of effector CD4 T cell populations. Annu Rev Immunol. (2010) 28:44589. 10.1146/annurev-immunol-030409-101212

  • 3.

    SzaboSJKimSTCostaGLZhangXFathmanCGGlimcherLH. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell. (2000) 100:65569. 10.1016/S0092-8674(00)80702-3

  • 4.

    SzaboSJSullivanBMPengSLGlimcherLH. Molecular mechanisms regulating Th1 immune responses. Annu Rev Immunol. (2003) 21:71358. 10.1146/annurev.immunol.21.120601.140942

  • 5.

    MosmannTRCoffmanRL. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol. (1989) 7:14573. 10.1146/annurev.iy.07.040189.001045

  • 6.

    ZhengWFlavellRA. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell. (1997) 89:58796. 10.1016/S0092-8674(00)80240-8

  • 7.

    AggarwalSGhilardiNXieMHde SauvageFJGurneyAL. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J Biol Chem. (2003) 278:19104. 10.1074/jbc.M207577200

  • 8.

    BettelliECarrierYGaoWKornTStromTBOukkaMet al. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. (2006) 441:2358. 10.1038/nature04753

  • 9.

    HarringtonLEHattonRDManganPRTurnerHMurphyTLMurphyKMet al. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol. (2005) 6:112332. 10.1038/ni1254

  • 10.

    LangrishCLChenYBlumenscheinWMMattsonJBashamBSedgwickJDet al. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med. (2005) 201:23340. 10.1084/jem.20041257

  • 11.

    ManganPRHarringtonLEO'QuinnDBHelmsWSBullardDCElsonCOet al. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature. (2006) 441:2314. 10.1038/nature04754

  • 12.

    ParkHLiZYangXOChangSHNurievaRWangYHet al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol. (2005) 6:113341. 10.1038/ni1261

  • 13.

    FerberIABrockeSTaylor-EdwardsCRidgwayWDiniscoCSteinmanLet al. Mice with a disrupted IFN-gamma gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J Immunol. (1996) 156:57.

  • 14.

    KuchrooVKAndersonACWaldnerHMunderMBettelliENicholsonLB. T cell response in experimental autoimmune encephalomyelitis (EAE): role of self and cross-reactive antigens in shaping, tuning, and regulating the autopathogenic T cell repertoire. Annu Rev Immunol. (2002) 20:10123. 10.1146/annurev.immunol.20.081701.141316

  • 15.

    WildbaumGYoussefSGrabieNKarinN. Neutralizing antibodies to IFN-gamma-inducing factor prevent experimental autoimmune encephalomyelitis. J Immunol. (1998) 161:636874.

  • 16.

    BousheyH. Targets for asthma therapy. Allergie Immunol. (2000) 32:33641.

  • 17.

    PaulWE. History of interleukin-4. Cytokine. (2015) 75:37. 10.1016/j.cyto.2015.01.038

  • 18.

    BettelliEKornTOukkaMKuchrooVK. Induction and effector functions of T(H)17 cells. Nature. (2008) 453:10517. 10.1038/nature07036

  • 19.

    KornTBettelliEOukkaMKuchrooVK. IL-17 and Th17 cells. Annu Rev Immunol. (2009) 27:485517. 10.1146/annurev.immunol.021908.132710

  • 20.

    VeldhoenMHockingRJAtkinsCJLocksleyRMStockingerB. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity. (2006) 24:17989. 10.1016/j.immuni.2006.01.001

  • 21.

    YablonskiDWeissA. Mechanisms of signaling by the hematopoietic-specific adaptor proteins, SLP-76 and LAT and their B cell counterpart, BLNK/SLP-65. Adv Immunol. (2001) 79:93128. 10.1016/S0065-2776(01)79003-7

  • 22.

    GorentlaBKZhongXP. T cell receptor signal transduction in T lymphocytes. J Clin Cell Immunol. (2012) 2012(Suppl 12):5. 10.4172/2155-9899.S12-005

  • 23.

    GettAVSallustoFLanzavecchiaAGeginatJ. T cell fitness determined by signal strength. Nat Immunol. (2003) 4:35560. 10.1038/ni908

  • 24.

    LozzaLRivinoLGuardaGJarrossayDRinaldiABertoniFet al. The strength of T cell stimulation determines IL-7 responsiveness, secondary expansion, and lineage commitment of primed human CD4+IL-7Rhi T cells. Eur J Immunol. (2008) 38:309. 10.1002/eji.200737852

  • 25.

    PurvisHAStoopJNMannJWoodsSKozijnAEHambletonSet al. Low-strength T-cell activation promotes Th17 responses. Blood. (2010) 116:482937. 10.1182/blood-2010-03-272153

  • 26.

    TuboNJPaganAJTaylorJJNelsonRWLinehanJLErteltJMet al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. (2013) 153:78596. 10.1016/j.cell.2013.04.007

  • 27.

    ZhaYMarksRHoAWPetersonACJanardhanSBrownIet al. T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase-alpha. Nat Immunol. (2006) 7:116673. 10.1038/ni1394

  • 28.

    ZhongXPGuoRZhouHLiuCWanCK. Diacylglycerol kinases in immune cell function and self-tolerance. Immunol Rev. (2008) 224:24964. 10.1111/j.1600-065X.2008.00647.x

  • 29.

    MeridaIAndradaEGharbiSIAvila-FloresA. Redundant and specialized roles for diacylglycerol kinases alpha and zeta in the control of T cell functions. Sci Signal. (2015) 8:re6. 10.1126/scisignal.aaa0974

  • 30.

    KrishnaSZhongX. Role of diacylglycerol kinases in T cell development and function. Crit Rev Immunol. (2013) 33:97118. 10.1615/CritRevImmunol.2013006696

  • 31.

    YamashitaMShinnakasuRAsouHKimuraMHasegawaAHashimotoKet al. Ras-ERK MAPK cascade regulates GATA3 stability and Th2 differentiation through ubiquitin-proteasome pathway. J Biol Chem. (2005) 280:2940919. 10.1074/jbc.M502333200

  • 32.

    MarslandBJSoosTJSpathGLittmanDRKopfM. Protein kinase C theta is critical for the development of in vivo T helper (Th)2 cell but not Th1 cell responses. J Exp Med. (2004) 200:1819. 10.1084/jem.20032229

  • 33.

    Salek-ArdakaniSSoTHaltemanBSAltmanACroftM. Differential regulation of Th2 and Th1 lung inflammatory responses by protein kinase C theta. J Immunol. (2004) 173:64407. 10.4049/jimmunol.173.10.6440

  • 34.

    Salek-ArdakaniSSoTHaltemanBSAltmanACroftM. Protein kinase Ctheta controls Th1 cells in experimental autoimmune encephalomyelitis. J Immunol. (2005) 175:763541. 10.4049/jimmunol.175.11.7635

  • 35.

    ZhongXPHaineyEAOlenchockBAZhaoHTophamMKKoretzkyGA. Regulation of T cell receptor-induced activation of the Ras-ERK pathway by diacylglycerol kinase zeta. J Biol Chem. (2002) 277:3108998. 10.1074/jbc.M203818200

  • 36.

    GorentlaBKWanCKZhongXP. Negative regulation of mTOR activation by diacylglycerol kinases. Blood. (2011) 117:402231. 10.1182/blood-2010-08-300731

  • 37.

    SanjuanMAPradet-BaladeBJonesDRMartinezACStoneJCGarcia-SanzJAet al. T cell activation in vivo targets diacylglycerol kinase alpha to the membrane: a novel mechanism for Ras attenuation. J Immunol. (2003) 170:287783. 10.4049/jimmunol.170.6.2877

  • 38.

    ZhongXPHaineyEAOlenchockBAJordanMSMaltzmanJSNicholsKEet al. Enhanced T cell responses due to diacylglycerol kinase zeta deficiency. Nat Immunol. (2003) 4:88290. 10.1038/ni958

  • 39.

    OlenchockBAGuoRCarpenterJHJordanMTophamMKKoretzkyGAet al. Disruption of diacylglycerol metabolism impairs the induction of T cell anergy. Nat Immunol. (2006) 7:117481. 10.1038/ni1400

  • 40.

    ShinJO'BrienTFGraysonJMZhongXP. Differential regulation of primary and memory CD8 T cell immune responses by diacylglycerol kinases. J Immunol. (2012) 188:21117. 10.4049/jimmunol.1102265

  • 41.

    JingWGershanJAHolzhauerSWeberJPalenKMcOlashLet al. T cells deficient in diacylglycerol kinase zeta are resistant to PD-1 inhibition and help create persistent host immunity to leukemia. Cancer Res. (2017) 77:567686. 10.1158/0008-5472.CAN-17-1309

  • 42.

    RieseMJWangLCMoonEKJoshiRPRanganathanAJuneCHet al. Enhanced effector responses in activated CD8+ T cells deficient in diacylglycerol kinases. Cancer Res. (2013) 73:356677. 10.1158/0008-5472.CAN-12-3874

  • 43.

    RuffoEMalacarneVLarsenSEDasRPatrussiLWulfingCet al. Inhibition of diacylglycerol kinase alpha restores restimulation-induced cell death and reduces immunopathology in XLP-1. Sci Transl Med. (2016) 8:321ra7. 10.1126/scitranslmed.aad1565

  • 44.

    BaldanziGPighiniABettioVRaineroETrainiSChianaleFet al. SAP-mediated inhibition of diacylglycerol kinase alpha regulates TCR-induced diacylglycerol signaling. J Immunol. (2011) 187:594151. 10.4049/jimmunol.1002476

  • 45.

    SchmidtAMLuWSindhavaVJHuangYBurkhardtJKYangEet al. Regulatory T cells require TCR signaling for their suppressive function. J Immunol. (2015) 194:436270. 10.4049/jimmunol.1402384

  • 46.

    ArumugamVBluemnTWesleyESchmidtAMKambayashiTMalarkannanSet al. TCR signaling intensity controls CD8+ T cell responsiveness to TGF-beta. J leuk Biol. (2015) 98:70312. 10.1189/jlb.2HIMA1214-578R

  • 47.

    SchmidtAMZouTJoshiRPLeichnerTMPimentelMASommersCLet al. Diacylglycerol kinase zeta limits the generation of natural regulatory T cells. Sci Signal. (2013) 6:ra101. 10.1126/scisignal.2004411

  • 48.

    JoshiRPSchmidtAMDasJPytelDRieseMJLesterMet al. The zeta isoform of diacylglycerol kinase plays a predominant role in regulatory T cell development and TCR-mediated ras signaling. Sci Signal. (2013) 6:ra102. 10.1126/scisignal.2004373

  • 49.

    Arranz-NicolasJOgandoJSoutarDArcos-PerezRMeraviglia-CrivelliDManesSet al. Diacylglycerol kinase alpha inactivation is an integral component of the costimulatory pathway that amplifies TCR signals. Cancer Immunol Immunother. (2018) 67:96580. 10.1007/s00262-018-2154-8

  • 50.

    Avila-FloresAArranz-NicolasJAndradaESoutarDMeridaI. Predominant contribution of DGKzeta over DGKalpha in the control of PKC/PDK-1-regulated functions in T cells. Immunol Cell Biol. (2017) 95:54963. 10.1038/icb.2017.7

  • 51.

    AlmenaMAndradaELiebanaRMeridaI. Diacylglycerol metabolism attenuates T-cell receptor signaling and alters thymocyte differentiation. Cell Death Dis. (2013) 4:e912. 10.1038/cddis.2013.396

  • 52.

    ShenSWuJSrivatsanSGorentlaBKShinJXuLet al. Tight regulation of diacylglycerol-mediated signaling is critical for proper invariant NKT cell development. J Immunol. (2011) 187:21229. 10.4049/jimmunol.1100495

  • 53.

    ShenSChenYGorentlaBKLuJStoneJCZhongXP. Critical roles of RasGRP1 for invariant NKT cell development. J Immunol. (2011) 187:446773. 10.4049/jimmunol.1003798

  • 54.

    GuoRWanCKCarpenterJHMousallemTBoustanyRMKuanCTet al. Synergistic control of T cell development and tumor suppression by diacylglycerol kinase alpha and zeta. Proc Natl Acad Sci USA. (2008) 105:1190914. 10.1073/pnas.0711856105

  • 55.

    PanYDengWXieJZhangSWanECKLiLet al. Graded diacylglycerol kinases alpha and zeta activities ensure mucosal-associated invariant T-cell development in mice. Eur J Immunol. (2019). 10.1002/eji.201948289 [Epub ahead of print].

  • 56.

    Shapiro-ShelefMLinKISavitskyDLiaoJCalameK. Blimp-1 is required for maintenance of long-lived plasma cells in the bone marrow. J Exp Med. (2005) 202:14716. 10.1084/jem.20051611

  • 57.

    YangJZhangPKrishnaSWangJLinXHuangHet al. Unexpected positive control of NFkappaB and miR-155 by DGKalpha and zeta ensures effector and memory CD8+ T cell differentiation. Oncotarget. (2016) 7:3374464. 10.18632/oncotarget.8164

  • 58.

    BarndenMJAllisonJHeathWRCarboneFR. Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Immunol Cell Biol. (1998) 76:3440. 10.1046/j.1440-1711.1998.00709.x

  • 59.

    MichelMLKellerACPagetCFujioMTrotteinFSavagePBet al. Identification of an IL-17-producing NK1.1(neg) iNKT cell population involved in airway neutrophilia. J Exp Med. (2007) 204:9951001. 10.1084/jem.20061551

  • 60.

    KudoMMeltonACChenCEnglerMBHuangKERenXet al. IL-17A produced by alphabeta T cells drives airway hyper-responsiveness in mice and enhances mouse and human airway smooth muscle contraction. Nat Med. (2012) 18:54754. 10.1038/nm.2684

  • 61.

    YangXOPappuBPNurievaRAkimzhanovAKangHSChungYet al. T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity. (2008) 28:2939. 10.1016/j.immuni.2007.11.016

  • 62.

    IvanovIIMcKenzieBSZhouLTadokoroCELepelleyALafailleJJet al. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell. (2006) 126:112133. 10.1016/j.cell.2006.07.035

  • 63.

    ManelNUnutmazDLittmanDR. The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat Immunol. (2008) 9:6419. 10.1038/ni.1610

  • 64.

    HamiltonKSPhongBCoreyCChengJGorentlaBZhongXet al. T cell receptor-dependent activation of mTOR signaling in T cells is mediated by Carma1 and MALT1, but not Bcl10. Sci Signal. (2014) 7:ra55. 10.1126/scisignal.2005169

  • 65.

    LeeKGudapatiPDragovicSSpencerCJoyceSKilleenNet al. Mammalian target of rapamycin protein complex 2 regulates differentiation of Th1 and Th2 cell subsets via distinct signaling pathways. Immunity. (2010) 32:74353. 10.1016/j.immuni.2010.06.002

  • 66.

    DelgoffeGMPollizziKNWaickmanATHeikampEMeyersDJHortonMRet al. The kinase mTOR regulates the differentiation of helper T cells through the selective activation of signaling by mTORC1 and mTORC2. Nat Immunol. (2011) 12:295303. 10.1038/ni.2005

  • 67.

    YangKShresthaSZengHKarmausPWNealeGVogelPet al. T cell exit from quiescence and differentiation into Th2 cells depend on Raptor-mTORC1-mediated metabolic reprogramming. Immunity. (2013) 39:104356. 10.1016/j.immuni.2013.09.015

  • 68.

    ZengHCohenSGuyCShresthaSNealeGBrownSAet al. mTORC1 and mTORC2 kinase signaling and glucose metabolism drive follicular helper T cell differentiation. Immunity. (2016) 45:54054. 10.1016/j.immuni.2016.08.017

  • 69.

    YangJLinXPanYWangJChenPHuangHet al. Critical roles of mTOR Complex 1 and 2 for T follicular helper cell differentiation and germinal center responses. eLife. (2016) 5:e17936. 10.7554/eLife.17936

  • 70.

    WheelerMLDongMBBrinkRZhongXPDeFrancoAL. Diacylglycerol kinase zeta limits B cell antigen receptor-dependent activation of ERK signaling to inhibit early antibody responses. Sci Signal. (2013) 6:ra91. 10.1126/scisignal.2004189

  • 71.

    OlenchockBAGuoRSilvermanMAWuJNCarpenterJHKoretzkyGAet al. Impaired degranulation but enhanced cytokine production after Fc epsilonRI stimulation of diacylglycerol kinase zeta-deficient mast cells. J Exp Med. (2006) 203:147180. 10.1084/jem.20052424

  • 72.

    LiuCHMachadoFSGuoRNicholsKEBurksAWAlibertiJCet al. Diacylglycerol kinase zeta regulates microbial recognition and host resistance to Toxoplasma gondii. J Exp Med. (2007) 204:78192. 10.1084/jem.20061856

  • 73.

    YangESinghBKPaustianAMKambayashiT. Diacylglycerol kinase zeta is a target to enhance NK cell function. J Immunol. (2016) 197:93441. 10.4049/jimmunol.1600581

  • 74.

    KarmausPWFChenXLimSAHerradaAANguyenTMXuBet al. Metabolic heterogeneity underlies reciprocal fates of TH17 cell stemness and plasticity. Nature. (2019) 565:1015. 10.1038/s41586-018-0806-7

  • 75.

    KleinewietfeldMManzelATitzeJKvakanHYosefNLinkerRAet al. Sodium chloride drives autoimmune disease by the induction of pathogenic TH17 cells. Nature. (2013) 496:51822. 10.1038/nature11868

  • 76.

    WuCYosefNThalhamerTZhuCXiaoSKishiYet al. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1. Nature. (2013) 496:5137. 10.1038/nature11984

  • 77.

    DuYNTangXFXuLChenWDGaoPJHanWQ. SGK1-FoxO1 signaling pathway mediates Th17/Treg imbalance and target organ inflammation in angiotensin II-induced hypertension. Front Physiol. (2018) 9:1581. 10.3389/fphys.2018.01581

Summary

Keywords

Th differentiation, Th17, Th1, mTOR, DGK, airway inflammation

Citation

Yang J, Wang H-X, Xie J, Li L, Wang J, Wan ECK and Zhong X-P (2020) DGK α and ζ Activities Control TH1 and TH17 Cell Differentiation. Front. Immunol. 10:3048. doi: 10.3389/fimmu.2019.03048

Received

26 April 2019

Accepted

12 December 2019

Published

15 January 2020

Volume

10 - 2019

Edited by

Hongbo Chi, St. Jude Children's Research Hospital, United States

Reviewed by

Xuexian Yang, University of New Mexico, United States; Greg M. Delgoffe, University of Pittsburgh, United States

Updates

Copyright

*Correspondence: Xiao-Ping Zhong

This article was submitted to T Cell Biology, a section of the journal Frontiers in Immunology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics